ID: 1148274479

View in Genome Browser
Species Human (GRCh38)
Location 17:46291369-46291391
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 3, 1: 0, 2: 2, 3: 5, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG + Intronic
902389060 1:16092240-16092262 GTGAGCAGGACTCTGACAGCGGG - Intergenic
902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG + Intergenic
904152617 1:28454908-28454930 CTGAGCTGGTCTCAAACTGCTGG - Intronic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
913386767 1:118266443-118266465 GTGAGCTGAACTTGAACTGCTGG + Intergenic
919377402 1:196811164-196811186 GTTAGCATGACTAAAACTCAGGG + Intergenic
919988269 1:202690986-202691008 GTGAGTAGGACGAGAACTGGAGG - Intronic
922608203 1:226904345-226904367 GTGAGCAGTGCTAAATATGCAGG - Intronic
1068502006 10:57851465-57851487 GTTATCAGAAATAAAACTGCTGG - Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1073757265 10:106593901-106593923 GGAAGCAGGACTAAGACTCCTGG - Intronic
1074641639 10:115390621-115390643 ATGAGCAAGAATAAAACTGAAGG - Intronic
1076220658 10:128730701-128730723 GTGAGCAGGACCAGGCCTGCAGG + Intergenic
1077309689 11:1882838-1882860 TTGAGCAGGACTGAACCTGGAGG - Intronic
1077801207 11:5539532-5539554 GTGAGTAGGACTAAAATCCCAGG + Intronic
1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG + Intergenic
1086596405 11:88576921-88576943 ATGAGTCTGACTAAAACTGCAGG - Intronic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1089912414 11:122114900-122114922 GTGAGTAGAACTAAATCTGTGGG - Intergenic
1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG + Intergenic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1098066943 12:66628492-66628514 GTTAACAGGACTAAAAGGGCTGG - Intronic
1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG + Intronic
1102174330 12:110865082-110865104 GTAAGCAGGACTAAACCAGCTGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107095769 13:36533441-36533463 GTAAGCAGGATTCAAAATGCTGG - Intergenic
1107280504 13:38728282-38728304 CTGAGCAGGATTAAAACTCTAGG + Intronic
1109213849 13:59565291-59565313 CTGAACAGGACTTTAACTGCAGG - Intergenic
1112751895 13:102591920-102591942 GAGAGCAGGACTGAAAATGTGGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1118706467 14:68484841-68484863 GTATGCAGGACAAAATCTGCTGG - Intronic
1130990435 15:88872730-88872752 GATAGCAGCACAAAAACTGCTGG - Intronic
1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG + Intergenic
1133282814 16:4676748-4676770 GTGAGCAGGACTGGCACTGTGGG + Intronic
1141598302 16:85110663-85110685 GTGGGCAGGAATATAAATGCGGG + Intronic
1143315511 17:6029377-6029399 GTGCCCAGGACTAGAATTGCTGG + Intronic
1146495558 17:33318960-33318982 GTGGGAAGGACTAAAATGGCAGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151710158 17:75799907-75799929 CTGAGCAGGTCTCAAACTCCTGG - Intronic
1153652134 18:7250188-7250210 GTGAGCTGGATTGAATCTGCAGG - Intergenic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1155277204 18:24199680-24199702 GAGAGAAGGACTATTACTGCAGG + Intronic
1156257056 18:35408858-35408880 GAGACCAGGACCAAAACTGTGGG - Intergenic
1163002633 19:14378152-14378174 GTCAGCAGGACTGAGACTTCAGG + Intergenic
1163064163 19:14780940-14780962 GTCAGCAGGACTGAGACTTCTGG - Intergenic
1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG + Intronic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
927289163 2:21388116-21388138 ATGAGAAGGAATAAAACTTCAGG + Intergenic
929709933 2:44256430-44256452 GTGTGCAGGGCTGCAACTGCTGG - Intergenic
930112781 2:47693279-47693301 CTAAGCTGGACTAAAACTCCTGG + Intergenic
931974761 2:67630834-67630856 GTGAGAAGGACTAAATCTAGGGG + Intergenic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
940191797 2:151048519-151048541 GTTAGCAGATATAAAACTGCTGG - Intronic
942888043 2:180952593-180952615 GTAAGCAGGACTGAATCTGAAGG - Intergenic
942927120 2:181447183-181447205 GTCACCAGGTCTAAAAATGCCGG + Intergenic
944883917 2:204043513-204043535 GTGAGCAGGATTTCAACTCCTGG - Intergenic
945396406 2:209324309-209324331 GTGAGCATGTCTAAAAATGTTGG - Intergenic
947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG + Intronic
1175679962 20:60978891-60978913 GTGCGGAGGAGTAGAACTGCTGG + Intergenic
1175691298 20:61067719-61067741 GTGAGCAGCAGTAGAACTGGGGG - Intergenic
1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG + Intronic
1184901630 22:47449953-47449975 GTGAGAGAGACTAAACCTGCTGG - Intergenic
1184965900 22:47972102-47972124 GTGACCAGGACCAACACAGCAGG - Intergenic
949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG + Intergenic
953844550 3:46417021-46417043 GTGAGCAGGCCTACAGGTGCTGG - Intergenic
955403898 3:58613302-58613324 GGGAGCAGGAGTCAAACTGTGGG + Intronic
956355447 3:68387181-68387203 GAAAGCAGGACTAAAAGTTCTGG + Intronic
960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG + Intronic
961958431 3:130828288-130828310 GTGAGCAGGGCTGAGACTGTGGG - Intergenic
963558183 3:146823891-146823913 GTTAGCTGAACTAAAACTACTGG + Intergenic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
965890565 3:173508701-173508723 ATGAGCAGGACAAAAACTCAAGG - Intronic
966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG + Intronic
978989181 4:115056687-115056709 CTGAGCATGACCAAAAATGCAGG - Intronic
980104356 4:128573448-128573470 GTGAGCAAAACAAAAGCTGCTGG + Intergenic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
986520222 5:8607787-8607809 GTGAGTGTGACTAGAACTGCAGG + Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987591547 5:19934256-19934278 GTGAGAAGGACTTAATGTGCTGG + Intronic
993921220 5:93805526-93805548 CTGAGCAGTAATAAAACAGCAGG + Intronic
994630629 5:102281885-102281907 ATGCCCAGGAGTAAAACTGCTGG - Intronic
995756566 5:115511402-115511424 GTGAGCAGCACTACAACAGGAGG + Intergenic
1000595415 5:163209942-163209964 TGTAGCAGGACTAAAAATGCTGG + Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006654076 6:35575565-35575587 ATGAGCTGGACTTAAGCTGCTGG + Exonic
1015571763 6:134629077-134629099 GGAAGCAGGAATAAAACTGGTGG + Intergenic
1019317600 7:396744-396766 GTGAGCAGGATGCATACTGCAGG - Intergenic
1022477402 7:30720474-30720496 GTGAGCAGGACTTTAAAGGCAGG - Intronic
1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG + Intronic
1023624893 7:42106196-42106218 GTGAGCAGCATGGAAACTGCGGG - Intronic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1028764029 7:94530311-94530333 GTCAGCTCCACTAAAACTGCTGG - Intronic
1032272733 7:130425631-130425653 GTGCTCAGGAGTACAACTGCTGG - Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1037780053 8:21861711-21861733 GTGGGCAGGGCTAAAGCTTCTGG + Intergenic
1041810947 8:61909749-61909771 GATAGCATGACTAACACTGCAGG - Intergenic
1043573411 8:81630483-81630505 GTGACCAGGACAGAAACAGCAGG - Intergenic
1043578445 8:81685800-81685822 GTGACCAGGACAGAAACAGCAGG - Exonic
1045501204 8:102745616-102745638 GTGAGCAGGAATGTTACTGCAGG + Intergenic
1045829806 8:106445433-106445455 ATGAGCAGTTCTCAAACTGCAGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048326517 8:133443271-133443293 GTGAGCAAGACCACATCTGCTGG - Intergenic
1057837395 9:98456048-98456070 CTGAGCTGGACTAGAAATGCTGG - Intronic
1060021900 9:120138927-120138949 ATGAGCAAGACCAAAACTACTGG + Intergenic
1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG + Intergenic
1061842767 9:133369205-133369227 GTGTGCAGAACTGACACTGCAGG - Intronic
1061987642 9:134139082-134139104 ACGAGCAGGACTCACACTGCAGG - Intronic
1189880624 X:45487742-45487764 GTGAGAAGTACAAAAATTGCGGG + Intergenic