ID: 1148276995

View in Genome Browser
Species Human (GRCh38)
Location 17:46313208-46313230
Sequence CCCCAGTGCTGTCTTCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 4, 1: 1, 2: 0, 3: 17, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148276990_1148276995 11 Left 1148276990 17:46313174-46313196 CCAAAAAGAAACATGGTACCCAT 0: 4
1: 5
2: 42
3: 232
4: 972
Right 1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG 0: 4
1: 1
2: 0
3: 17
4: 186
1148276991_1148276995 -7 Left 1148276991 17:46313192-46313214 CCCATTAGCCATCACTCCCCAGT 0: 5
1: 7
2: 39
3: 206
4: 899
Right 1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG 0: 4
1: 1
2: 0
3: 17
4: 186
1148276987_1148276995 30 Left 1148276987 17:46313155-46313177 CCAGAACATTTTCATCATCCCAA 0: 23
1: 239
2: 795
3: 1570
4: 2427
Right 1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG 0: 4
1: 1
2: 0
3: 17
4: 186
1148276992_1148276995 -8 Left 1148276992 17:46313193-46313215 CCATTAGCCATCACTCCCCAGTG 0: 5
1: 1
2: 15
3: 80
4: 592
Right 1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG 0: 4
1: 1
2: 0
3: 17
4: 186
1148276989_1148276995 12 Left 1148276989 17:46313173-46313195 CCCAAAAAGAAACATGGTACCCA 0: 4
1: 3
2: 26
3: 178
4: 1013
Right 1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG 0: 4
1: 1
2: 0
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148276995 Original CRISPR CCCCAGTGCTGTCTTCCCGC AGG Intronic