ID: 1148278988

View in Genome Browser
Species Human (GRCh38)
Location 17:46332474-46332496
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 2, 1: 4, 2: 2, 3: 14, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148278983_1148278988 27 Left 1148278983 17:46332424-46332446 CCTGGGTGACAGAGTGAGACCCT 0: 6598
1: 26231
2: 68050
3: 126125
4: 184175
Right 1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG 0: 2
1: 4
2: 2
3: 14
4: 164
1148278984_1148278988 8 Left 1148278984 17:46332443-46332465 CCCTCTTTCAAAAAAATAAAAAA 0: 6
1: 62
2: 2247
3: 29149
4: 165052
Right 1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG 0: 2
1: 4
2: 2
3: 14
4: 164
1148278985_1148278988 7 Left 1148278985 17:46332444-46332466 CCTCTTTCAAAAAAATAAAAAAG 0: 5
1: 10
2: 274
3: 4147
4: 32857
Right 1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG 0: 2
1: 4
2: 2
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900441443 1:2657535-2657557 CAGATGCTCACCTGGAGTTCTGG - Intronic
900444229 1:2671945-2671967 CAGATGCTCACCTGGAGTTCTGG - Intronic
900445134 1:2676601-2676623 CAGATGCTCACCTGGAGTTCTGG - Intronic
900445843 1:2680335-2680357 CAGATGCTCACCTGGAGTTCTGG - Intronic
900449875 1:2700529-2700551 CAGATTCTCACCTGGAAGAGTGG - Intronic
900450120 1:2701776-2701798 CAGATTCTCACCTGGAAGAGTGG - Intronic
900453333 1:2761480-2761502 CAGATTCTCACCTGGAAGAGTGG - Intronic
900453608 1:2762887-2762909 CAGATTCTCACCTGGAAGAGTGG - Intronic
900453812 1:2763933-2763955 CAGATTCTCACCTGGAAGAGTGG - Intronic
900453849 1:2764136-2764158 CAGATTCTCACCTGGAAGAGTGG - Intronic
900454321 1:2766472-2766494 CAGATTCTCACCTGGAAGAGTGG - Intronic
900454523 1:2767518-2767540 CAGATTCTCACCTGGAAGAGTGG - Intronic
900455050 1:2770148-2770170 CAGATTCTCACCTGGAAGAGTGG - Intronic
900455257 1:2771195-2771217 CAGATTCTCACCTGGAAGAGTGG - Intronic
900455293 1:2771398-2771420 CAGATTCTCACCTGGAAGAGTGG - Intronic
900455799 1:2773894-2773916 CAGATTCTCACCTGGAAGAGTGG - Intronic
900456003 1:2774940-2774962 CAGATTCTCACCTGGAAGAGTGG - Intronic
900456040 1:2775143-2775165 CAGATTCTCACCTGGAAGAGTGG - Intronic
901595672 1:10383512-10383534 CGTCTCCTCCCCTGGAATACTGG - Intergenic
902408843 1:16201333-16201355 CATCTGCTCAGCTGGAATAAAGG - Intronic
904354310 1:29928873-29928895 CCGCCACTCACCTGAAACACAGG - Intergenic
905539302 1:38747313-38747335 CACCGGCTCACCTGGAAGACAGG + Intergenic
905920695 1:41716730-41716752 CAGCCTCTCAGCTGGAATTCAGG - Intronic
907432345 1:54420439-54420461 CAGCTTCTCCCCTGGAAAATGGG - Intergenic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
910047405 1:82934034-82934056 CATGTACTCACCTGGAAAAAAGG + Intergenic
914923637 1:151864901-151864923 CAGCTCCTCACATGGAAAACAGG + Intergenic
917168889 1:172146727-172146749 CAGGTCTACACCTGGAATACTGG - Intronic
917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG + Intronic
918012891 1:180604022-180604044 CAGCTTCCCACCTGGGATGCAGG - Intergenic
918845775 1:189609625-189609647 CAGCTATTCAAATGGAATTCAGG - Intergenic
922322595 1:224501897-224501919 CAGCTACTTTCCTGGAAGAGGGG + Intronic
922557842 1:226546589-226546611 CAGCAAATCATCTGGAAAACTGG + Intergenic
1068968030 10:62933371-62933393 CAGGTACTCACATGGAATTTTGG - Intergenic
1069732211 10:70624499-70624521 CAGCTGTTCAGCTGGAATTCAGG + Intergenic
1071270009 10:83998350-83998372 GACCTACTCAGCTGGAAGACTGG - Intergenic
1075219374 10:120571412-120571434 CAGACACTCACTTGGAATGCAGG + Intronic
1075576929 10:123584419-123584441 CAGCCTCTCACCTCGAATTCTGG - Intergenic
1076256559 10:129031184-129031206 CAGCGACTCAGCTGGAACCCTGG - Intergenic
1077144423 11:1038346-1038368 CAGCTTCTCACCTGAACCACAGG - Intergenic
1081206310 11:40279995-40280017 CAGATACTCACCTGAAAGAAAGG - Intronic
1083999211 11:66287172-66287194 CAGCACCTCACCTGGCACACAGG - Intronic
1085796039 11:79540861-79540883 CTGCTGCTCACCTGGAAGACAGG - Intergenic
1087727192 11:101734243-101734265 CTGCTACACACCTAGAATATAGG - Intronic
1089983190 11:122789423-122789445 CAGCTCCTTTCCTGGAATTCTGG - Intronic
1090683992 11:129095452-129095474 CAGGTACTCACCAGGGATATCGG + Intronic
1091208279 11:133835397-133835419 CAGCTTCTCAGCTGCAATAGTGG + Intergenic
1097805576 12:63961342-63961364 CATCTCCTCACATGGAATTCTGG + Intronic
1101150415 12:101877909-101877931 CTGCCACTCACCTGATATACGGG - Exonic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104321658 12:127757199-127757221 TATCTCCTCAACTGGAATACAGG - Intergenic
1109309197 13:60672251-60672273 CAACCACTCACATGGAATAGTGG - Intergenic
1109821138 13:67656882-67656904 CAGCTACTGAGCGGGAATCCAGG - Intergenic
1109899704 13:68750772-68750794 TAGCTACATACTTGGAATACAGG - Intergenic
1111605088 13:90527987-90528009 AAGCAACTCACCTGGATTATTGG + Intergenic
1111619901 13:90711471-90711493 TATCTACTTACCTGAAATACAGG - Intergenic
1111886111 13:94023368-94023390 CATCTACTCAACTTAAATACTGG + Intronic
1114059230 14:19003813-19003835 CAGCTACTTACCTGGAAATAAGG - Intergenic
1114103315 14:19397941-19397963 CAGCTACTTACCTGGAAATAAGG + Intergenic
1115725043 14:36204799-36204821 CAGTTCCTCATCTGGAAAACGGG - Intergenic
1122388774 14:101366075-101366097 CAGCCACTCAGCTGCAATTCTGG - Intergenic
1122388781 14:101366120-101366142 CAGCCACTCAGCTGCAATTCTGG - Intergenic
1122388787 14:101366165-101366187 CAGCCACTCAGCTGCAATTCTGG - Intergenic
1122388793 14:101366210-101366232 CAGCCACTCAGCTGCAATTCTGG - Intergenic
1202836695 14_GL000009v2_random:82963-82985 CAGCTACTCACCTGGAAACAAGG - Intergenic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1124946565 15:34272740-34272762 CAGCTAATCACCTGCAGTAAAGG - Intronic
1126846525 15:52765643-52765665 TAGGTACTGGCCTGGAATACAGG - Intronic
1128451366 15:67807560-67807582 CAGCTCCTCACCTGCAAAATGGG - Intergenic
1128591939 15:68905797-68905819 CTGCTAAAGACCTGGAATACAGG - Intronic
1128943957 15:71809264-71809286 CAGTTCCTCACCTGTAAAACAGG - Intronic
1132642214 16:983080-983102 CTGCTCCTCACCTGGAAGAAGGG + Intronic
1132803447 16:1765167-1765189 CAGCTGCTCACCGGGGATGCTGG - Exonic
1133036872 16:3038490-3038512 CAGCTACTCACCTGGCGTCACGG + Intergenic
1135635933 16:24075575-24075597 CAGCTATTCTGCTGGAATTCAGG + Intronic
1135860001 16:26047548-26047570 CATCTTCTCACCTGGAAAGCAGG - Intronic
1135915220 16:26599513-26599535 CAGCTATTCCACTGGAATTCAGG + Intergenic
1138329106 16:56198990-56199012 GAGCTACTGACCTGGACTCCTGG - Intronic
1139674229 16:68511844-68511866 CAGCTACTCACCTGGCAGGCAGG + Intergenic
1203143862 16_KI270728v1_random:1786708-1786730 CAGATACTCACCTGGGATGCGGG - Intergenic
1143876119 17:9991966-9991988 CAGTTACTCACCAGAACTACTGG + Intronic
1146171086 17:30633894-30633916 AAGCTACTCAACTGGAATACTGG + Intergenic
1146344543 17:32049898-32049920 AAGCTACTCAACTGGCATACTGG + Intronic
1148170219 17:45513351-45513373 AAGCTACTCACCTGGAATACTGG - Intergenic
1148170696 17:45517344-45517366 AAGCTACTCACCTGGAATACTGG - Intergenic
1148178898 17:45589352-45589374 CAGTTACTCATCTGTAAAACAGG - Intergenic
1148270257 17:46257093-46257115 CAGTTACTCATCTGTAAAACAGG + Intergenic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1148365329 17:47051208-47051230 AAGCTACTCACCTGGAATACTGG + Intergenic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149467254 17:56889991-56890013 CAGCTACACACCTGACATGCAGG - Exonic
1150401310 17:64858927-64858949 AAGCTACTCACCTGGAATACTGG - Intronic
1150766713 17:68008133-68008155 CAGTTACTCATCTGTAAAACAGG - Intergenic
1150781418 17:68125954-68125976 AAGCTACTCAACTAGAATACTGG - Intergenic
1152991389 18:366790-366812 CAGCAAATCACCTAGAAGACTGG - Intronic
1154291546 18:13112445-13112467 CAGCTAATCCCCTGGAAAGCAGG - Intronic
1156474951 18:37399671-37399693 CAGCTGCACACCTGTAGTACAGG + Intronic
1159310971 18:66708462-66708484 CAGCACATCACCTGGAATATGGG - Intergenic
1159462430 18:68738381-68738403 CAGACTCTTACCTGGAATACGGG + Intronic
1162191304 19:8949136-8949158 CAGCACCTCAGCTGAAATACTGG - Exonic
1166200358 19:41233667-41233689 CAGTTCCTCACCTTGAAAACGGG - Intronic
1166298709 19:41902385-41902407 CAGCTAGACACATGGAATTCAGG + Intronic
1167018005 19:46854211-46854233 GAGCGAGCCACCTGGAATACAGG - Intergenic
1167439517 19:49500252-49500274 CAGCTACTCACTGGGACTTCAGG - Intergenic
1167682872 19:50935982-50936004 CCTCTTCTCACCTGGAATATGGG - Intergenic
1167918665 19:52762884-52762906 CAGCTATTGACCTTGAAAACAGG + Intergenic
1167934059 19:52892058-52892080 CAGCTACTGACCTTGAAAACAGG + Intronic
1202635934 1_KI270706v1_random:44404-44426 CAGCTACTTACCTGGAAACAAGG + Intergenic
927114456 2:19887002-19887024 CAGCAACCTACCTGGAATAGGGG - Intergenic
930382237 2:50645970-50645992 CAGATACTCAACTGGCATGCTGG + Intronic
930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG + Intergenic
931768235 2:65475769-65475791 CAGTTACTTACCTGTAAAACGGG - Intergenic
934150054 2:89137537-89137559 CAGCTATTCTACTGGAATTCAGG + Intergenic
934217242 2:90044491-90044513 CAGCTATTCTACTGGAATTCAGG - Intergenic
934481862 2:94656752-94656774 CAGGTGCTCACCTGTAATTCAGG + Intergenic
936748714 2:115614066-115614088 CAGCTGTTCAGCTGGAATTCAGG + Intronic
937706389 2:124925720-124925742 CAATTTCTCACCTGGAAAACTGG + Intergenic
938281953 2:130070428-130070450 CAGCTACTTACCTGGAAATAAGG + Intergenic
938332577 2:130459000-130459022 CAGCTACTTACCTGGAAATAAGG + Intergenic
938357231 2:130661671-130661693 CAGCTACTTACCTGGAAATAAGG - Intergenic
938477693 2:131631065-131631087 CAGCTACTTACCTGGAAATAAGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940690162 2:156907163-156907185 CAGTTTCTTATCTGGAATACTGG - Intergenic
944596373 2:201265211-201265233 CAGCTAATTACCTAGAATAATGG - Intronic
1168805009 20:667324-667346 CAGCCACTGAGCTGGAATCCTGG - Intronic
1169404221 20:5309976-5309998 CAGGTACACAGCTGGAATCCAGG - Intronic
1169900663 20:10549037-10549059 CAGTTACTCACGTGAAACACTGG - Intronic
1171321524 20:24248621-24248643 CAGCTTCACATCTGGGATACAGG - Intergenic
1171882088 20:30625460-30625482 CAGCTACTTACCTGGAAATAAGG + Intergenic
1174522419 20:51141894-51141916 CAGTTTCTCACCTGTAAAACTGG + Intergenic
1178383610 21:32132050-32132072 CAACAATTCACCTTGAATACAGG - Intergenic
1180364778 22:11928836-11928858 CAGCTACTTACCTGGAAACAAGG - Intergenic
1180477712 22:15726429-15726451 CAGCTACTTACCTGGAAATAAGG - Intergenic
1181821539 22:25479534-25479556 CAGATACTCAGCCGGAATTCTGG - Intergenic
1182073502 22:27479242-27479264 CAGCTCCTCACCTGGAAACGGGG - Intergenic
1183748492 22:39705761-39705783 CACCTTCTCACCTGCAAAACAGG - Intergenic
955064314 3:55521508-55521530 GAGCTACTCACCTGGAAAAGTGG - Intronic
955440878 3:58953767-58953789 CAGCTCTTCACTTGTAATACAGG + Intronic
961204953 3:125074607-125074629 CACCTGCTCACCTGGAATTTCGG - Intergenic
965382114 3:168002816-168002838 CAGCTGCTCTGCTGGAAGACAGG - Intergenic
966050425 3:175610986-175611008 CAGTTTCTCACCTGTAATATTGG - Intronic
970686343 4:18572223-18572245 CAGTTTCTCACCTGTAAAACAGG + Intergenic
971849964 4:31972286-31972308 CAGCTACTCATCTAGAAAACTGG - Intergenic
973365756 4:49207920-49207942 CAGCTACTTACCTGGAAATAAGG + Intergenic
973394841 4:49584533-49584555 CAGCTACTTACCTGGAAATAAGG - Intergenic
977135397 4:93297609-93297631 TATCTACTCATCTGGAAAACTGG + Intronic
979504961 4:121485310-121485332 GATCTACTCACCTGGAACAGAGG + Intergenic
1202763255 4_GL000008v2_random:130267-130289 CAGCTACTTACCTGGAAACAAGG + Intergenic
992838710 5:80666718-80666740 CAGCTTATCACCTGTAATAATGG - Intronic
992865574 5:80953986-80954008 CCACTTCTCACCTGGACTACTGG - Intergenic
995870749 5:116740938-116740960 CAGCTTCTGGCCTGGCATACAGG + Intergenic
996078445 5:119226718-119226740 CACCTACACATCTGGCATACTGG + Intronic
998082930 5:139292063-139292085 CAGCTACTCACCTGGTACGGAGG - Intronic
998348344 5:141484581-141484603 AAGCTACTCATTTAGAATACTGG + Intronic
1007370580 6:41424462-41424484 CAGCTTCTCATCTGTAAAACGGG + Intergenic
1012122584 6:95386272-95386294 CACAGAATCACCTGGAATACTGG + Intergenic
1012279199 6:97309285-97309307 CAATTTCTCACCTGGAATATGGG - Intergenic
1012313663 6:97758761-97758783 AAGCTACTCATCTTGAGTACAGG - Intergenic
1013300638 6:108802008-108802030 CAGCTTCTCATCTGGATTACTGG + Intergenic
1020963995 7:14843088-14843110 CAGCTACTCAGGGGGAATAGTGG + Intronic
1022882050 7:34598277-34598299 CATCTCCTCATCTGTAATACTGG - Intergenic
1024979581 7:55146186-55146208 CAGCCCCTCACCTGGCATCCAGG + Intronic
1026118509 7:67516644-67516666 CAGTTTCTCACCTGTAAAACGGG + Intergenic
1027786798 7:82590309-82590331 CAGCTGGTAACGTGGAATACTGG + Intergenic
1027946120 7:84748585-84748607 CAGGTGCTAACCTGGAATCCGGG - Intergenic
1030073261 7:105715529-105715551 CAGCTACCCTCCTGGATAACTGG + Intronic
1030344847 7:108421675-108421697 CAGTTCCTTATCTGGAATACAGG - Intronic
1031885167 7:127238814-127238836 CACCTCCTCTGCTGGAATACAGG - Intronic
1036382496 8:8246231-8246253 CAGCTACTCACATGGGAGTCAGG - Intergenic
1037449484 8:19002286-19002308 CAGCAACTCACAAGGAAGACGGG - Intronic
1041085334 8:54251380-54251402 AGGCCACTCACCTGGAACACTGG - Intergenic
1042701401 8:71618814-71618836 CTGCTTCCCACCTGGAATTCTGG - Intergenic
1045448894 8:102299441-102299463 CAGATTCTTACCTGGAATAGTGG + Exonic
1049268117 8:141680416-141680438 CAGCTCCTCTCCTGGGATGCAGG + Intergenic
1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG + Intergenic
1055289380 9:74767033-74767055 CAGCAACTCACCTAGGATCCAGG + Intronic
1059116964 9:111608492-111608514 AAGCTACTCACCTGTAATACTGG - Intergenic
1060283920 9:122232339-122232361 CAGTTCCTCACCTGCAAAACGGG + Intergenic
1062002100 9:134221415-134221437 CAGCCACTGAACTGCAATACCGG + Intergenic
1203544019 Un_KI270743v1:115138-115160 CAGCTACTTACCTGGAAACAAGG + Intergenic
1187097121 X:16161055-16161077 CCTCTTCTCACCTGGAGTACAGG - Intergenic
1188555651 X:31409295-31409317 GAGCTGCTCACATGGTATACAGG + Intronic
1189302417 X:39961571-39961593 CAGTTGCTCACCTGGGCTACAGG - Intergenic
1195725640 X:107912820-107912842 CATCTACTCACCTTCAATACTGG + Intronic
1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG + Intergenic