ID: 1148289858

View in Genome Browser
Species Human (GRCh38)
Location 17:46435569-46435591
Sequence AGAATCTAAGAGGATCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148289858_1148289865 21 Left 1148289858 17:46435569-46435591 CCATGTAGATCCTCTTAGATTCT No data
Right 1148289865 17:46435613-46435635 GATTGGTCCTGAATGGCACTAGG No data
1148289858_1148289861 -1 Left 1148289858 17:46435569-46435591 CCATGTAGATCCTCTTAGATTCT No data
Right 1148289861 17:46435591-46435613 TGAATTTAGGAAAGACCTCTTGG No data
1148289858_1148289864 14 Left 1148289858 17:46435569-46435591 CCATGTAGATCCTCTTAGATTCT No data
Right 1148289864 17:46435606-46435628 CCTCTTGGATTGGTCCTGAATGG No data
1148289858_1148289862 4 Left 1148289858 17:46435569-46435591 CCATGTAGATCCTCTTAGATTCT No data
Right 1148289862 17:46435596-46435618 TTAGGAAAGACCTCTTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148289858 Original CRISPR AGAATCTAAGAGGATCTACA TGG (reversed) Intergenic
No off target data available for this crispr