ID: 1148291511

View in Genome Browser
Species Human (GRCh38)
Location 17:46455243-46455265
Sequence AAGCCTTGAGCTTCTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148291511_1148291516 12 Left 1148291511 17:46455243-46455265 CCTCTAGGAGAAGCTCAAGGCTT No data
Right 1148291516 17:46455278-46455300 CCCTACCACTCATACTTGGAGGG No data
1148291511_1148291514 11 Left 1148291511 17:46455243-46455265 CCTCTAGGAGAAGCTCAAGGCTT No data
Right 1148291514 17:46455277-46455299 TCCCTACCACTCATACTTGGAGG No data
1148291511_1148291519 23 Left 1148291511 17:46455243-46455265 CCTCTAGGAGAAGCTCAAGGCTT No data
Right 1148291519 17:46455289-46455311 ATACTTGGAGGGTGAGTCAAAGG No data
1148291511_1148291513 8 Left 1148291511 17:46455243-46455265 CCTCTAGGAGAAGCTCAAGGCTT No data
Right 1148291513 17:46455274-46455296 ATCTCCCTACCACTCATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148291511 Original CRISPR AAGCCTTGAGCTTCTCCTAG AGG (reversed) Intergenic