ID: 1148299076

View in Genome Browser
Species Human (GRCh38)
Location 17:46530442-46530464
Sequence ATCTGGAATAGGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 533}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148299076 Original CRISPR ATCTGGAATAGGAAAGAGGA GGG Intronic
900130177 1:1084087-1084109 CTCGGGAACAGGAAAGAGCATGG + Intronic
901834055 1:11912277-11912299 ATCTGGAAACCGAAAGATGATGG - Intergenic
902058195 1:13619499-13619521 TTCATGAATAGGAAAGAGCAAGG + Intergenic
902130081 1:14252621-14252643 ATATGGAATAGGATGGAGTAGGG - Intergenic
902578307 1:17392422-17392444 TTCTGGAATGGGAAGGAGGCTGG - Intronic
903221541 1:21872376-21872398 ATCTGGCAGGGGAAAAAGGAGGG + Exonic
903545196 1:24119609-24119631 GTCTGGGGTGGGAAAGAGGAGGG - Intergenic
904724757 1:32539137-32539159 ATTTGGTTTAGGAAAGAGGGAGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
906616853 1:47239319-47239341 ATCTGTAATAGGAATGGGGTGGG + Intergenic
906781043 1:48573093-48573115 ATCTAGAATAGGGAAGGGGCAGG - Intronic
907009139 1:50946523-50946545 TTCTGGAAGAAGAAAGATGAGGG - Intronic
908177666 1:61571914-61571936 ATCTGAAATAAGAAGGAAGAGGG + Intergenic
908858857 1:68460319-68460341 ATATGAAAGAGGAAAGAAGAAGG - Intergenic
908879517 1:68715007-68715029 ATATGAAATAGGAAAGAAGATGG + Intergenic
908940592 1:69428212-69428234 TTCAGGAAGAGGACAGAGGAAGG - Intergenic
909068604 1:70964924-70964946 ATCTTGGATAGCAAAGAAGATGG + Intronic
909396334 1:75174640-75174662 TTCTGAAACAGGAAATAGGATGG - Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
909955461 1:81773474-81773496 CTCTGGAATAAAACAGAGGAAGG - Intronic
910162861 1:84292578-84292600 ATCTGGAGTTGGTAAGAGAATGG - Intergenic
910304432 1:85746604-85746626 ATCTGGAAAATGTAAGAGGTTGG + Intronic
910366470 1:86470736-86470758 ATCTGGAACATCAAATAGGAAGG - Intronic
910508052 1:87972569-87972591 ATCTGGAAAAAGAAAAGGGAAGG + Intergenic
911358199 1:96846641-96846663 AACTGGAATAGGGATGGGGAGGG + Intergenic
911742575 1:101403265-101403287 ATCTGGAGTGGGAAGGAGTATGG + Intergenic
911940282 1:104037454-104037476 ATCTGGATTAAGATAGATGATGG - Intergenic
911943360 1:104074462-104074484 ACCTGGTTTAGGAAAGATGACGG - Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912580831 1:110719454-110719476 ATCTGAAAGAGCAAATAGGAGGG - Intergenic
913154138 1:116077810-116077832 ATAGGGAATAGGAAGTAGGAGGG + Intergenic
913988561 1:143586901-143586923 ACCTGGAATAGGAAAAAGACGGG + Intergenic
914209654 1:145565418-145565440 ACCTGGAATAGGAAAAAGATGGG + Intergenic
914368518 1:147003076-147003098 ACCTGGAATAGGAAAAAGATGGG - Intergenic
916509760 1:165461707-165461729 CTCTAGAATAGGAGAGAGGATGG - Intergenic
916945036 1:169717962-169717984 ATTTGGAATAGGAAAGGTCATGG + Intronic
919144672 1:193618757-193618779 ATCTGGAAGAGAAATCAGGAAGG + Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
920398803 1:205664448-205664470 ATCTGGAACAGGAAGGAAGGAGG + Intronic
920442242 1:205989048-205989070 AGGTGGAATAGGATAGGGGAGGG - Intronic
920580623 1:207104127-207104149 ATGAGGACTAGCAAAGAGGAAGG + Intergenic
920664281 1:207949742-207949764 CTCTGCCATAGGAAACAGGAAGG - Intergenic
921046318 1:211480227-211480249 ATCTGGAGGAAGAAAGGGGAGGG + Intronic
921324722 1:213979420-213979442 CTTTGGAATAGGAGAGAAGAAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921989107 1:221344986-221345008 ATAGGGAATGGGAAAGAGTATGG - Intergenic
923344908 1:233042330-233042352 TTCAGGCAAAGGAAAGAGGAGGG - Intronic
923877507 1:238065081-238065103 ATATGGAGTAGAAAAGAAGAAGG + Intergenic
1063469808 10:6275247-6275269 CTCTGGAAGAGGACAGAGAAGGG - Intergenic
1063899196 10:10714370-10714392 ACCTGGAATATAAAACAGGATGG + Intergenic
1064536061 10:16359075-16359097 ATCTGGAATTGGCAAGAAGGAGG - Intergenic
1064622290 10:17228850-17228872 AGCGGGAAGAGGAAAGAGTAAGG - Intronic
1066197078 10:33110855-33110877 CTCTGGAATAGGGAAGAGCGAGG - Intergenic
1066315540 10:34242400-34242422 ATCCGTAAAAGGAAAGACGATGG + Intronic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1068681717 10:59827104-59827126 AGCAGGGATAGGATAGAGGAGGG + Intronic
1068866192 10:61897707-61897729 AGCTGGAAGAGGAAAGAAAAGGG + Intergenic
1069316987 10:67117376-67117398 AACTGGAACAGGAAAGGGAAAGG - Intronic
1069670238 10:70196331-70196353 ATTATGAAAAGGAAAGAGGATGG - Intergenic
1070089942 10:73274695-73274717 ATCTGAAAAAGAAAAGAGAAAGG - Intronic
1070387365 10:75938018-75938040 TACTGGAATAGGATGGAGGATGG + Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070976563 10:80610084-80610106 GTCTGAGATGGGAAAGAGGATGG - Intronic
1071085737 10:81866884-81866906 AGCTGGTACAGGAAAAAGGAAGG - Intergenic
1071222864 10:83490206-83490228 GTGTGGCATAGGAAAGAGCATGG + Intergenic
1071913157 10:90258516-90258538 ATATGGAATGGGAAGGAGAAGGG + Intergenic
1072830094 10:98648291-98648313 AGCTGGGAAAGGAAAGAGGTAGG + Intronic
1073548754 10:104377476-104377498 AAGTGGGATAGGAAAAAGGAGGG - Intronic
1074062628 10:109981300-109981322 ACCTGGAAAGGGAAAGGGGATGG + Intergenic
1075317038 10:121460993-121461015 GTCTGGATTAGGAAAGAGTAAGG + Intergenic
1075354788 10:121761749-121761771 ACCAGGAATGGGGAAGAGGATGG - Intronic
1075540021 10:123304578-123304600 ATCTTGAATATGGAAGAGGATGG - Intergenic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078968049 11:16370586-16370608 ATATGGAGTAGGCAAGAGGGAGG - Intronic
1079088577 11:17464813-17464835 ATCTGGTCTAGGAGGGAGGAGGG - Intronic
1079455264 11:20630905-20630927 TTCTGGAACAGGATAGAGGGTGG + Intronic
1079561789 11:21830212-21830234 AACTGGAATACTAAAGAAGACGG - Intergenic
1080564913 11:33499126-33499148 AACTGAAATGGGAAAGAGGAAGG - Intergenic
1081208516 11:40303218-40303240 ATCTGGAGTTGGAGAGAGAAGGG + Intronic
1081875850 11:46408012-46408034 ACCTGAAATAGGTGAGAGGAAGG + Intronic
1082017605 11:47503240-47503262 AACTGGATTAGAAAAGAGAAAGG + Intronic
1083548857 11:63570145-63570167 ATTTGGAAAAGTAAAGAGGCAGG - Intergenic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1086115603 11:83246181-83246203 ATCAGGAAAAAGAAATAGGATGG + Intronic
1086120375 11:83299421-83299443 CTCTGGAGTAGGAAATAGCAAGG + Intergenic
1086549308 11:88036447-88036469 ATATGGAATAGGAAAAGGCAAGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087520158 11:99223015-99223037 ATTTGGAAAAGAAAAGATGAAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088136792 11:106565161-106565183 AACTGGAAGAGAAAGGAGGAAGG + Intergenic
1088149654 11:106728331-106728353 AACTGGGATAGCAGAGAGGATGG - Intronic
1088368395 11:109062766-109062788 ATCTGAAATAAGAAACAGGTGGG - Intergenic
1088378950 11:109172402-109172424 ATACGGAATAGGAGACAGGAAGG - Intergenic
1088548387 11:110985148-110985170 TTTGGGAATAGGAAAGAGGGAGG + Intergenic
1089003861 11:115074627-115074649 ATCAGAAATAGGTAGGAGGATGG + Intergenic
1089121038 11:116135312-116135334 ATCTCAATTAGGAAAAAGGAGGG - Intergenic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091697087 12:2634998-2635020 ATTTGGAAGAGGAACGAGAAGGG + Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092899758 12:13046965-13046987 ATCTGAAATAGTAAAGGAGATGG + Intronic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095200009 12:39372906-39372928 AGGTGGAATAGGGAAGAGGGAGG - Intronic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096087196 12:48873679-48873701 AGCTGGACTAAGAATGAGGAGGG + Intergenic
1096532072 12:52248570-52248592 AGCTGGGAGAGAAAAGAGGAGGG - Exonic
1096670530 12:53195843-53195865 CTATGGAATAGGAAGGAGGTAGG + Intronic
1096679133 12:53243131-53243153 ATCTGGCATAGGGATGAGGGAGG + Intergenic
1097496202 12:60339107-60339129 ATCTGAAATGGGAAAGTGAAAGG - Intergenic
1097656028 12:62364444-62364466 ATCTAGAGTTGGAAAGAGAAAGG + Intronic
1097937790 12:65272977-65272999 ATGTGGAATGTGAAAGAAGAAGG - Intergenic
1098342272 12:69464635-69464657 ATTCTGCATAGGAAAGAGGAAGG + Intergenic
1099290945 12:80775821-80775843 ATCTGATATATGGAAGAGGAAGG + Intergenic
1099303928 12:80931874-80931896 ATCAGGGGTAGAAAAGAGGAGGG - Intronic
1099374016 12:81874237-81874259 AACTGGACTTTGAAAGAGGACGG - Intergenic
1099528944 12:83751662-83751684 ATGATGAATAGGATAGAGGATGG - Intergenic
1099552997 12:84071893-84071915 ATCGGGATTATGAAAGAGGATGG - Intergenic
1099611005 12:84869670-84869692 AAGTTGAATTGGAAAGAGGAAGG - Intronic
1100041032 12:90317482-90317504 ATCAGGAATAGGAAAAAGAGGGG + Intergenic
1100638923 12:96462470-96462492 ATGTGGAATAGTAAAGCAGATGG + Intergenic
1100881695 12:99025598-99025620 ATTTGAAATAGGAAAGGGCAAGG + Intronic
1100900633 12:99236697-99236719 ATGTTGAATAGGAATAAGGAGGG + Intronic
1101366564 12:104076899-104076921 ATCTGGCATAGGCAAGAAAAGGG - Intronic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1102124368 12:110468592-110468614 ATCTGGAATACTGAAGTGGAAGG + Exonic
1103794866 12:123496344-123496366 ATCTGGGATACAAATGAGGAAGG - Intronic
1105051905 12:133061609-133061631 CTCTGGGATTGGAAAGAGAATGG - Exonic
1106759318 13:32852163-32852185 ACCTGGGTTAGGACAGAGGAGGG + Intergenic
1107843475 13:44485072-44485094 ATATGGTAAAAGAAAGAGGATGG - Intronic
1107882755 13:44847185-44847207 TTCTGGAAAAGGAAAAAGTATGG - Intergenic
1108248205 13:48538866-48538888 TCCTGGAACAGGAAAAAGGAGGG - Intergenic
1108415377 13:50193107-50193129 ATCTCGAAGAGGCAAGTGGAAGG - Intronic
1108826071 13:54414080-54414102 ATTTGGAATAGGAAAAATTACGG - Intergenic
1109058010 13:57577320-57577342 ATCTGAATCAGTAAAGAGGAAGG - Intergenic
1109063403 13:57651037-57651059 TTCTAAAATATGAAAGAGGATGG + Intronic
1110442743 13:75543350-75543372 AGCTGGAATAGGAAAGAAAATGG + Intronic
1110509150 13:76328604-76328626 AGCTGGAAAAGGAAAGAAAATGG - Intergenic
1111725165 13:91998303-91998325 ATCTTGAAGAGCAAAGTGGAAGG - Intronic
1111853275 13:93603951-93603973 ATCTGGAATAGAAAAATGGCAGG + Intronic
1112103600 13:96216941-96216963 ATCAGGAATCGGAAGGAGCAGGG - Intronic
1112988413 13:105480836-105480858 AGATGGAATAAGATAGAGGAAGG - Intronic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1114050487 14:18916727-18916749 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1114112070 14:19485205-19485227 AGCTGGCATGGGAAGGAGGATGG + Intergenic
1114474309 14:22982816-22982838 AATTGGAATAGGAAAGAGTGTGG + Intergenic
1114524587 14:23359848-23359870 ATCTGGAGTGGGAAGGAGGCCGG - Exonic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1115820999 14:37212188-37212210 AGTTGGAAAAGTAAAGAGGATGG + Intronic
1115960076 14:38826029-38826051 ATTTGAAGTAGGTAAGAGGAAGG - Intergenic
1115977002 14:39007857-39007879 ATCTGGAACAGGAAATAATAGGG - Intergenic
1116424138 14:44768801-44768823 ATCTGAACCAGGAAAAAGGAGGG - Intergenic
1117234768 14:53760720-53760742 ATCTGCAATATCAAAGAGAAAGG + Intergenic
1117544119 14:56777631-56777653 GTCTGTACTAGGAAAGAAGAAGG + Intergenic
1118398012 14:65354217-65354239 ATCTGTAACCTGAAAGAGGAAGG + Intergenic
1118844320 14:69535340-69535362 ACCTGGAAAAGGAAAGGGTAGGG - Intergenic
1119176790 14:72574396-72574418 AACTGGCATTGCAAAGAGGAAGG + Intergenic
1119679260 14:76579708-76579730 AGCTGGAAAAGGAAAGAAAATGG - Intergenic
1119680356 14:76587825-76587847 AGCTGGAAAAGGAAAGAAAATGG - Intergenic
1120281612 14:82445879-82445901 ATCTGGAAGAAGAAAAAGGATGG + Intergenic
1121415269 14:93774935-93774957 ATCACGAAGAGGAAAGAGCAGGG + Intronic
1121459018 14:94059342-94059364 ATCAGGAATAAGAAATAGCATGG + Intronic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1122556657 14:102584197-102584219 AGCTGGTAGAGGAAAGAGTACGG + Intergenic
1123216581 14:106813758-106813780 AGCTGGAGCAGGACAGAGGATGG + Intergenic
1123980502 15:25597601-25597623 AACTGCAATTTGAAAGAGGAAGG - Intergenic
1124168292 15:27349088-27349110 ATAGGAAATAAGAAAGAGGAAGG + Intronic
1124620366 15:31270505-31270527 AGGAGGGATAGGAAAGAGGAAGG + Intergenic
1125093240 15:35820014-35820036 ATATTGAATATGAAAGAGGGAGG - Intergenic
1125511902 15:40296685-40296707 ATCTGGAACAGGAGAGGGGCTGG - Intronic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126405117 15:48315443-48315465 ATAAGGAATTGGAAAGGGGATGG + Intergenic
1128336739 15:66791378-66791400 TTCTTGAAGAGGAAAGATGAGGG + Intergenic
1128416065 15:67447258-67447280 ACTTGGGAAAGGAAAGAGGAAGG - Intronic
1128550480 15:68595258-68595280 AGCTGGAGGAGGAAAGAGGGAGG - Intronic
1128916227 15:71565404-71565426 CTCTGGAATAGGAGAGATGATGG - Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129009160 15:72399061-72399083 ACCTGGAATAGGAGAGAGAAAGG - Intronic
1129329532 15:74820023-74820045 ATCTGGAAGGGGACAGATGAAGG - Exonic
1129810970 15:78509484-78509506 ATCTGGAATAGAAAGGAGATTGG + Intronic
1130045470 15:80440781-80440803 CTCTGCAATAGAGAAGAGGATGG - Intronic
1130119814 15:81038184-81038206 ACATGGAGGAGGAAAGAGGAGGG + Intronic
1130285448 15:82550761-82550783 ATCTGAACTAGAAAAGAAGAAGG + Intronic
1130666663 15:85875045-85875067 ATATGGAAAAGGAAAGAAAACGG + Intergenic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1130842411 15:87713350-87713372 ATCGTGGATAGGAAGGAGGATGG - Intergenic
1130857171 15:87850642-87850664 ATCTGGAATAGAAAACAAGAAGG - Intergenic
1130919798 15:88334525-88334547 GTCTGGAAGAGGAAAGGAGAAGG + Intergenic
1132032615 15:98450810-98450832 ACCTGAAACAAGAAAGAGGAGGG + Intronic
1132828029 16:1914557-1914579 ATCTGGGAAAGGAAAGGGGTGGG - Intronic
1133369472 16:5237142-5237164 GTCTGGAAAAAAAAAGAGGAAGG + Intergenic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135530309 16:23247345-23247367 AGCTGGAAGAGGAAAGGGCATGG - Intergenic
1135894964 16:26391858-26391880 AGCTAAAATAGGAAAGAGTATGG - Intergenic
1136234154 16:28904159-28904181 ATCTGGAAGGGGAAAGAGAAGGG - Exonic
1136655168 16:31705324-31705346 GTCAGGAACAGGAGAGAGGAGGG - Intergenic
1137308743 16:47232062-47232084 AGCTGGAAAAGGTAAGGGGATGG + Intronic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1138492326 16:57383738-57383760 ATCTGTGAAAGGAAAGAGGGAGG + Exonic
1138503015 16:57460131-57460153 AGCCGGAATGGGAGAGAGGAGGG - Intronic
1138993673 16:62422197-62422219 AACTGGAAAAGGAAGCAGGAGGG - Intergenic
1139202418 16:64991692-64991714 AGCAGGAATAGGTTAGAGGAGGG + Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139903739 16:70348292-70348314 AACAGGAATAGGAAAGTGGGAGG + Intronic
1140075335 16:71693505-71693527 ATCTGAACTAGGGAATAGGAAGG - Intronic
1140215101 16:73000741-73000763 AACTGGAAAAGGACAGCGGATGG + Intronic
1140271132 16:73467232-73467254 ATCTTGAAGAGGAGAGAGAATGG + Intergenic
1140564772 16:76028599-76028621 ATCTGAAAAAGAAAAGAGTAGGG + Intergenic
1143007862 17:3848497-3848519 ATCGCGAACAGGAAAGGGGATGG - Intergenic
1143057226 17:4171427-4171449 ATCTGGGATAGGGAAGCAGAGGG - Intronic
1144942999 17:18954255-18954277 ATCTGAAGAGGGAAAGAGGAGGG + Intronic
1146497750 17:33338030-33338052 TTCTGGAAGGGCAAAGAGGATGG + Intronic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1146829151 17:36052353-36052375 ATCTGAATTAAAAAAGAGGAAGG + Intergenic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148703058 17:49602930-49602952 TTGAGGGATAGGAAAGAGGAAGG + Intronic
1149281577 17:55111073-55111095 AACTAGAATAGTGAAGAGGAAGG + Intronic
1149470962 17:56914570-56914592 TCCGGGAAGAGGAAAGAGGAAGG - Intergenic
1150002539 17:61451091-61451113 ATCTGGAAAGGGACAGAGGCTGG + Intergenic
1150347039 17:64412194-64412216 TTCTGCAGCAGGAAAGAGGAAGG + Intronic
1151122478 17:71808337-71808359 AGCTGGACTGGGAAAGAGCAGGG + Intergenic
1151446187 17:74165860-74165882 ATCTGGAAAGGGAAAAATGATGG + Intergenic
1152686128 17:81694640-81694662 ATCTGGAAGAGGAGAAAAGATGG + Intronic
1153504327 18:5780262-5780284 CTCTGGGCTAGGGAAGAGGAAGG - Intergenic
1153718836 18:7880706-7880728 TCCTGAAATAGGGAAGAGGAAGG - Intronic
1153904375 18:9648069-9648091 TTCTGGAATAGGTATGAGGACGG - Intergenic
1153929983 18:9869841-9869863 TTTTGGAATAGGACATAGGACGG - Intergenic
1154074594 18:11187823-11187845 AGCTGGAACAGGCAAGAAGATGG + Intergenic
1155138982 18:23025770-23025792 TTCTGGAATAAGAAAGAGCTTGG + Intronic
1155443469 18:25885450-25885472 TTCTGCTTTAGGAAAGAGGATGG + Intergenic
1155497161 18:26454064-26454086 GTCTGGAATGAGGAAGAGGAGGG + Intergenic
1156589307 18:38468040-38468062 ATATGGAATAACAAAAAGGAGGG - Intergenic
1157002482 18:43543076-43543098 ATCTGGAGAAGGAAAGAGTGAGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157944602 18:51965083-51965105 ATCCAGAATAGGAAAAAGTATGG - Intergenic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158848758 18:61472423-61472445 ATCTGGAACTGGCAAAAGGAGGG + Intronic
1159186699 18:64984147-64984169 ATCTAGAACAGGAAAGCAGATGG + Intergenic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1159276573 18:66230452-66230474 AACTGGAATAGGCAAGAAAATGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1161344130 19:3759599-3759621 CTCTGGAAGAAGATAGAGGAGGG + Exonic
1161630719 19:5353984-5354006 ACATGGAACAGGAAACAGGAAGG + Intergenic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1163395877 19:17060967-17060989 ACCTGGAAATGAAAAGAGGAAGG + Intronic
1165173979 19:33913875-33913897 ACATGCAATAGGAAAGAGGTGGG - Intergenic
1166054459 19:40280113-40280135 CTCTGGAATTGGAAAGACCAGGG - Intronic
1166270230 19:41708951-41708973 AACTGGAATTGGAAAGGGGCAGG + Intronic
1166415844 19:42594574-42594596 AACTGGAATTGGTAAGAGGCAGG - Intronic
1166423270 19:42654436-42654458 ATCTGGAATAGGTAAGAAGCAGG + Intronic
1166471347 19:43082000-43082022 AACTGGAATTGGTAAGAGGTAGG - Intronic
1166499630 19:43331154-43331176 AACTGGAATTGGAAAGGGGCAGG - Intergenic
1166984388 19:46650792-46650814 ATCTGGAATGGGAAGCAGAAAGG - Intronic
1167406129 19:49309958-49309980 ATTTGGAATAGGAGAGAGTGGGG - Intronic
1167495276 19:49814289-49814311 ATCTGCAAGAAGGAAGAGGAAGG - Intronic
1167513849 19:49911342-49911364 AGCTGGAAATGGAAAGAGGGAGG + Intronic
1167652575 19:50741011-50741033 ATCTGGAATCAGACAGAGGTTGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167730774 19:51252770-51252792 ATATGGAATAGGAAAGGACAGGG + Intronic
1168543544 19:57231808-57231830 ATCTGGAAAAGGAAGGAAGGTGG + Intronic
1202708668 1_KI270714v1_random:4471-4493 ACCTGGAATAGGAAAAAGATGGG - Intergenic
925639062 2:5969991-5970013 ATCTGGATTAGGAAGGAGAGAGG - Intergenic
925932027 2:8715842-8715864 ATCTAGAATAGGAGATGGGAAGG - Intergenic
926576354 2:14586477-14586499 AGCTGCAAAAGGCAAGAGGATGG + Intergenic
926782340 2:16484875-16484897 ATTTGGATAAGCAAAGAGGAAGG + Intergenic
927281590 2:21313372-21313394 AACTGGAAAGGGAAAGAGGGAGG + Intergenic
927361505 2:22240049-22240071 ATCTAGATTAGTAAACAGGAAGG - Intergenic
928746750 2:34424904-34424926 AGGTAGAATAGGAAAGAGAAAGG + Intergenic
929205913 2:39292622-39292644 AACTAGAATAGAAAAAAGGAAGG + Intronic
929269055 2:39952739-39952761 ATCTGTAAAAAGAATGAGGAAGG + Intergenic
929658844 2:43762156-43762178 ATCTCGCCTAGGAAAGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929960998 2:46496338-46496360 GTATGGTCTAGGAAAGAGGAAGG - Intronic
930603148 2:53465307-53465329 AGCTGGAAAAGGAAAGAAAATGG - Intergenic
930844988 2:55893898-55893920 ATCTGGAATATGCCAAAGGAGGG - Intronic
930923951 2:56792827-56792849 GTTTGGAATAGTAAAGAGCATGG + Intergenic
931852699 2:66268827-66268849 ATCTGGTCAAGGAAACAGGATGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934969363 2:98750589-98750611 ATAGGGAGTTGGAAAGAGGATGG - Intergenic
935061673 2:99614067-99614089 ATTTGGAAAAGGTGAGAGGAGGG + Intronic
936664270 2:114576345-114576367 GTCTTGAAGAGGGAAGAGGAGGG + Intronic
936737833 2:115468167-115468189 ATCTGGAAAAGGAAAAGTGATGG + Intronic
936799275 2:116246988-116247010 ATCAGGAAAAGAATAGAGGAAGG - Intergenic
937177384 2:119953874-119953896 ATCTGGAATTGTAAAAAGGCTGG - Intronic
937538729 2:122923415-122923437 ATCGGGAATTGGAAAGGGGATGG + Intergenic
938722634 2:134079948-134079970 AGCTGGAAAAGGCAAGAAGAAGG - Intergenic
939377447 2:141387767-141387789 TTCTGAAATATAAAAGAGGAAGG + Intronic
939773604 2:146356605-146356627 ATATGGAATAGGAAAAAAGTTGG + Intergenic
940732843 2:157414107-157414129 ATCTGGAATAGACTAGAGCAAGG + Intergenic
941399633 2:165014918-165014940 ATCTGGAAATGGGAAAAGGATGG - Intergenic
941933141 2:170962560-170962582 CTCTGGAATAAGAACGATGATGG - Intronic
943267354 2:185750693-185750715 TTCTGTATTAGAAAAGAGGAAGG - Intronic
943650370 2:190451460-190451482 ATCTGTAATAAGAAAGATAAAGG + Intronic
945397001 2:209331286-209331308 ATCTGGTGTGGGAAAGAGGCAGG + Intergenic
945617659 2:212093107-212093129 TTCTGGAATAGAAAAAAGTATGG - Intronic
945672499 2:212819140-212819162 ATCTGGAATTTTAAAGAGAATGG - Intergenic
946387970 2:219397222-219397244 ATGTGGAACAGGAAAGAGACGGG - Intronic
946474480 2:219994362-219994384 AGATGGAAAAGGAAAGAGAAGGG - Intergenic
946605567 2:221400438-221400460 ATCAGGAATTGGAGAGAGGTTGG + Intergenic
946634387 2:221708110-221708132 ACTGGGAATAGGAAAGTGGAGGG - Intergenic
946849015 2:223886901-223886923 ATCTAAAATAAGAAATAGGAAGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
948143607 2:235692399-235692421 ATCTGGCTTAGGAAACAGGAGGG + Intronic
948202615 2:236140770-236140792 ATCTGGAAATCAAAAGAGGAGGG - Intergenic
948441022 2:237989266-237989288 ATCTGAAGTAGGAAAGATAATGG + Intronic
948964468 2:241366797-241366819 AACTGGAAAATGACAGAGGAAGG - Intronic
1169270340 20:4194477-4194499 ATGTGGAATATGAAAGAAAAAGG - Intergenic
1169280227 20:4260895-4260917 AACTGGATAAGGGAAGAGGAGGG + Intergenic
1169510444 20:6258441-6258463 ATGAGGATTAGGAAAGAGCAAGG - Intergenic
1169560423 20:6793952-6793974 AAATGGAATAGGAAAGAAAAAGG + Intergenic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1170454009 20:16515873-16515895 AACTTAAGTAGGAAAGAGGATGG - Intronic
1170723646 20:18905868-18905890 ATCTGGAAGAGGAAAGGAGTTGG + Intergenic
1171117365 20:22536606-22536628 ATCTGCAAAAGGAAAGTGAAAGG - Intergenic
1171277583 20:23870955-23870977 CTCAGGAACAGGCAAGAGGAAGG + Intergenic
1171408865 20:24932707-24932729 ATCGGTAATAAGAAAAAGGATGG - Intergenic
1172830638 20:37831245-37831267 AGCTGGGGTAGGAAAGAGGAGGG - Intronic
1173094484 20:40012023-40012045 ATCTGGAATGTGAAAGAAGAAGG + Intergenic
1173748107 20:45453505-45453527 TTCAGAAATAGAAAAGAGGATGG + Intergenic
1174341573 20:49900344-49900366 TTCAGGAGTAGGAAAGTGGATGG + Intergenic
1174582524 20:51582174-51582196 CTCTGGATTAGGAATAAGGATGG - Intergenic
1174697383 20:52573889-52573911 AGCTGGAACAGGGAAGAGGCTGG + Intergenic
1176015724 20:62930586-62930608 ATGTGAAATAGGAAAAAGGGAGG + Intronic
1177660338 21:24074517-24074539 ATCTGGAAGAAGAAAGATTAGGG - Intergenic
1178021789 21:28416708-28416730 ATCAGGGAAAGGAAAGAAGAGGG - Intergenic
1178270976 21:31189515-31189537 CTCTATGATAGGAAAGAGGATGG + Intronic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1180468963 22:15639101-15639123 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1180931547 22:19595746-19595768 CTCTGGAATAGGAGAGAGACAGG + Intergenic
1181934214 22:26427998-26428020 TTCTGGAATAGGGAGGAGGTGGG + Intergenic
1181974659 22:26720446-26720468 ATCTGGCCTAGGAATGATGATGG - Intergenic
1182024117 22:27104095-27104117 ATCAGGAAGGGGAAACAGGAGGG + Intergenic
1182064962 22:27424335-27424357 ATTTGGAAAAAGAAAGAGGGTGG - Intergenic
1182286647 22:29252531-29252553 GTCTGGACTAGGAAAGAGGAAGG + Intronic
1183102569 22:35592987-35593009 ATCAGAAATGGGAAAGAGGGAGG + Intergenic
1183645574 22:39124188-39124210 AGCTGCAGAAGGAAAGAGGAAGG - Intronic
1184350906 22:43943591-43943613 ATCTGCAAGAGCAACGAGGAAGG - Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949689994 3:6625335-6625357 ATCAGAAATGGGAAAAAGGAAGG + Intergenic
951678206 3:25266015-25266037 AGCTGGAAGAGGAATGAGAAGGG - Intronic
952061393 3:29515242-29515264 ACCTGGAAAAGGAAAGAGCATGG + Intronic
952853643 3:37749887-37749909 AACTGGCAAAGGAAAGAGGTTGG + Intronic
953527767 3:43708331-43708353 CTCTGGAATATTAAAGAGTAGGG + Intronic
953546383 3:43866644-43866666 ATCTGGAATGGCAAAGAGTGAGG + Intergenic
953769911 3:45771957-45771979 GTCTGGAATGGGGAAGGGGAAGG + Intronic
956021911 3:64942062-64942084 GTATGGAATGGGATAGAGGAGGG - Intergenic
957537221 3:81522143-81522165 GTCTGGAAGAGGAAAAAGCAGGG + Intronic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
957872853 3:86110538-86110560 TTCTGGAATTGGAAAGATAAAGG - Intergenic
958605932 3:96358471-96358493 ATGTTGAATAGGAATGAGGTGGG + Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
959951095 3:112181157-112181179 ATTATGAATAGTAAAGAGGAAGG + Intronic
960434193 3:117605462-117605484 AACTGGAATAGGAAAAAGGTAGG + Intergenic
961333379 3:126155920-126155942 CTCTGTGACAGGAAAGAGGAAGG + Intronic
962612948 3:137096232-137096254 ATCTGGAGTAAAATAGAGGAAGG - Intergenic
962786559 3:138773705-138773727 ATTTAGATTAGAAAAGAGGAAGG - Intronic
963346050 3:144097583-144097605 ATCAGGAACAGAAAAGAGTAAGG - Intergenic
963451300 3:145484372-145484394 AACTGAAAGAGGAAAGAGGGAGG + Intergenic
963686778 3:148445093-148445115 ATATGGAAAAGGAAAGAAAAAGG + Intergenic
965309537 3:167112302-167112324 TTCTGAAGTGGGAAAGAGGATGG + Intergenic
965537983 3:169844064-169844086 TTCTGGAAAATAAAAGAGGAAGG + Intronic
965732996 3:171792342-171792364 AGGTGGAATAGATAAGAGGATGG - Intronic
965778814 3:172261848-172261870 ATCTGGAATGGGGAAGGGAATGG - Intronic
966258910 3:177951565-177951587 TTCTGGAATGGGAAAGATGAAGG - Intergenic
966895915 3:184444948-184444970 GTCTGGAGAAGGAAAGAGAAGGG - Intronic
967102053 3:186223575-186223597 AGATGGAATAGGGAAGAGAAGGG - Intronic
967474759 3:189903453-189903475 ATCTCTAAGAGGAAAGAGGCTGG + Intergenic
967738603 3:192980826-192980848 ATCTGGAATAGGGAAGTGAGGGG + Intergenic
968142380 3:196269036-196269058 AGCTGGAAAAGGCAAGAAGATGG + Intronic
969604299 4:8194716-8194738 ATCAGGAAAGGGACAGAGGACGG + Intronic
969939494 4:10716647-10716669 AAAAGGAATAGGAAAGAGGCAGG + Intergenic
970473125 4:16396162-16396184 ATCTGGAATAACAAAGGGTAGGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
971138190 4:23893254-23893276 ATTTGGAGTAGGAGTGAGGAAGG - Intronic
971318649 4:25587611-25587633 TGCTGGACTAGGGAAGAGGAGGG - Intergenic
971639524 4:29113292-29113314 ATCTGGTGTAGGACAGATGAGGG - Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
972285851 4:37647438-37647460 TTCTGAAAGAGAAAAGAGGAGGG + Exonic
973166249 4:47081010-47081032 ATCTGGGATAAAAAAGAAGAGGG + Intronic
973331410 4:48913424-48913446 AGCTGGAATAAGAAAAAGAATGG - Intergenic
973956319 4:56066891-56066913 GTCTAGAAGAGGAAAGAAGATGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976429775 4:84948933-84948955 ATATGGAATCTGAAATAGGAGGG - Intronic
976874441 4:89836827-89836849 ATATTTAATAGGAAAGAAGAAGG + Intronic
976971795 4:91112756-91112778 AGATGGAAGAGGACAGAGGATGG - Intronic
977048814 4:92101003-92101025 GTTGGGAATAGGAAACAGGAGGG - Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
978213815 4:106172734-106172756 ATCTGGAAGAGGGAAAAAGAAGG + Intronic
978368223 4:108004653-108004675 ATCTGTCATAGGAAAGAGGTTGG + Intronic
978724540 4:111955137-111955159 ATCAGGAAAAGGAAAGAGGAGGG - Intergenic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979157958 4:117421879-117421901 ATCTGTGGCAGGAAAGAGGAAGG + Intergenic
979323560 4:119352535-119352557 AGCAAGAATAGGATAGAGGAAGG + Intergenic
979384853 4:120052897-120052919 ATCAGTAATAGGAAATAGAATGG + Intergenic
979786735 4:124724249-124724271 AGCAGGAAATGGAAAGAGGATGG - Intergenic
980314852 4:131185540-131185562 ATCCTTAAAAGGAAAGAGGAAGG + Intergenic
980492359 4:133544377-133544399 ACCTGGAAAAGCAAAGAGGTTGG - Intergenic
980692051 4:136308340-136308362 AACTGGACTGGGAAAGAGGTTGG - Intergenic
981500566 4:145447105-145447127 TTCTGAAAGAGAAAAGAGGAGGG + Intergenic
981904809 4:149910192-149910214 AGATGGAATAGGATATAGGAAGG + Intergenic
982160379 4:152563076-152563098 ACCTGGAATTGGACAAAGGATGG + Intergenic
982235292 4:153246643-153246665 ATAGGGAGTAGGAAAGAGGGTGG + Intronic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983512352 4:168622212-168622234 ATTTGGCATAGGGAGGAGGATGG - Intronic
983840683 4:172454249-172454271 AACTGGAATAGGACCAAGGATGG - Intronic
984443794 4:179807158-179807180 TTCTGGAAAATTAAAGAGGAGGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
988227824 5:28435691-28435713 ATTTGGAATAGGAAATAAGATGG + Intergenic
988578158 5:32445820-32445842 GACTGGAAGAGGAAAGAGAATGG - Intergenic
988879021 5:35480116-35480138 ATCTGAAATAGCCAAGAGCAAGG - Intergenic
989209113 5:38842693-38842715 AGATGGAAGATGAAAGAGGATGG + Intergenic
989301342 5:39897626-39897648 AGCTGGAAAATGAAAGAGTAGGG - Intergenic
989785967 5:45329961-45329983 ATATGTAATTGGAAAGAAGATGG - Intronic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990848744 5:60176266-60176288 ACCTGCAAGAAGAAAGAGGATGG - Intronic
991229146 5:64310765-64310787 ATCTGGAAGGGGAAAGAGTGTGG + Intronic
991257969 5:64636312-64636334 ATCTGAAATATGAAAGAGCTTGG - Intergenic
991621698 5:68551525-68551547 ATATGCAATAGAAAGGAGGATGG - Intergenic
992245778 5:74820861-74820883 ATATGGATTAGGAGAGAGGCAGG - Intronic
992533483 5:77674026-77674048 TTCTGAATTAGGAAAGATGAAGG + Intergenic
993458928 5:88159264-88159286 ATCTGGAAAAGGAGATAGAATGG + Intergenic
994504563 5:100625772-100625794 ATCTGGAATGAAAGAGAGGAGGG - Intergenic
994894796 5:105688752-105688774 TTCTGACATAGGGAAGAGGATGG - Intergenic
995326695 5:110897861-110897883 AACAGGAATAGAAAAGAGCAGGG + Intergenic
995572814 5:113498979-113499001 TTCTGAAAAAAGAAAGAGGAGGG - Intergenic
996214280 5:120848555-120848577 ACCTGGAATAGCCAGGAGGAAGG - Intergenic
996429183 5:123352324-123352346 GTCTTAAATAGGAAAGAGCACGG - Intronic
996637411 5:125709902-125709924 AAATGGAAAAGGGAAGAGGATGG + Intergenic
996643404 5:125786293-125786315 AGCTTGAATAGCAAGGAGGAAGG - Intergenic
997673234 5:135693742-135693764 ATCTGCCATGGGAAAAAGGAGGG + Intergenic
998600851 5:143583419-143583441 ACCAGGTGTAGGAAAGAGGAGGG + Intergenic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999549880 5:152675142-152675164 AAATGGAATAGGAAACAAGAAGG + Intergenic
1001272946 5:170329384-170329406 ATTTGGGATAGAAATGAGGAAGG - Intergenic
1002001393 5:176198149-176198171 AGCTGGAGGAGGAATGAGGAAGG + Intergenic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1002252946 5:177940820-177940842 AGCTGGAGGAGGAATGAGGAAGG - Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003599062 6:7501272-7501294 TGCTGGTATTGGAAAGAGGAGGG + Intergenic
1004535496 6:16496896-16496918 ATCTGCAAGATGAAGGAGGAGGG - Intronic
1004554453 6:16682114-16682136 ATCTTTAATAAGAAAGAAGAAGG - Intronic
1005156324 6:22810945-22810967 TTCTGTGATAGTAAAGAGGAGGG - Intergenic
1005433590 6:25784020-25784042 ATCTGGAGTAACAATGAGGAAGG + Intronic
1005925540 6:30442143-30442165 ATGTGGATTAGGAAATGGGATGG - Intergenic
1005997097 6:30938218-30938240 ATCTGGGAGAGGAAGAAGGAAGG - Intergenic
1006135385 6:31892733-31892755 ATCTGGAAGAAGAGAGAGAATGG + Exonic
1006226778 6:32545295-32545317 AACTGGAATAGAAATGATGAGGG - Intergenic
1006429131 6:33984433-33984455 ATCTGGCCCAGGGAAGAGGAGGG + Intergenic
1006714314 6:36105349-36105371 ACTTGGGATAGGGAAGAGGAAGG - Intronic
1007837612 6:44686119-44686141 ATCCTGAACATGAAAGAGGATGG + Intergenic
1008585066 6:52941240-52941262 TTATGTAACAGGAAAGAGGAAGG + Intergenic
1010096306 6:72050433-72050455 GTCTGAAATATTAAAGAGGATGG - Intronic
1010278398 6:73995134-73995156 ATCTGGACTTGCAAAGAGGCAGG + Intergenic
1010959684 6:82131810-82131832 ATCTGGAGGAGGAAAGAGTGTGG - Intergenic
1011631351 6:89328327-89328349 ATCTTGAATAGTATAGGGGAGGG - Exonic
1011690491 6:89862929-89862951 ATCTAGAAGAGAGAAGAGGATGG + Exonic
1011765729 6:90617479-90617501 AAGAGGAATAGGGAAGAGGAAGG - Intergenic
1011887564 6:92116150-92116172 AATAGGAATAGGAAACAGGAGGG + Intergenic
1012060381 6:94471120-94471142 AACAGGCATAGGAAAGATGACGG - Intergenic
1012985500 6:105871561-105871583 ATATCAAAAAGGAAAGAGGATGG - Intergenic
1013670875 6:112401097-112401119 AGCTGGAAAAGGAAAGAAAATGG - Intergenic
1015265237 6:131285072-131285094 ATCTGGAATTGGAAAGAGTTTGG + Intergenic
1015326722 6:131931988-131932010 ATCTGGCATTGGAAAGACTAGGG - Intergenic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015797915 6:137031737-137031759 ATCAAGAAAATGAAAGAGGATGG + Intronic
1018817287 6:167343081-167343103 ATCTGCCATAGGACAGAGGTTGG + Intronic
1019762873 7:2826723-2826745 TTCTGGAAAAGGAAAAACGATGG + Intronic
1020367979 7:7400607-7400629 ATCTGTAATGCCAAAGAGGAAGG - Intronic
1020378313 7:7513439-7513461 ATCAGGAGCAGGAAAGAGGGAGG + Intronic
1022009309 7:26294800-26294822 ATCTGTAAAAAGAAAGAAGAAGG - Intronic
1022233451 7:28437879-28437901 TTCTGGAACAGAAAAGACGATGG + Intronic
1022415377 7:30172598-30172620 AACTGGAAAAGGAAAGCAGATGG - Intergenic
1022844171 7:34193199-34193221 ATCTCTAACATGAAAGAGGAGGG + Intergenic
1024036065 7:45508616-45508638 AACAGGAATAGGAAAGAGTAAGG + Intergenic
1025020815 7:55477741-55477763 ATTTGGAATATAAAAGAGAACGG + Intronic
1026134341 7:67646417-67646439 GCCTGGGAGAGGAAAGAGGAAGG - Intergenic
1027929258 7:84510096-84510118 ATCAGGCAGAGGAAAGTGGATGG + Intergenic
1028317773 7:89424935-89424957 TACTGGAATAGGGAAGTGGAAGG + Intergenic
1030198954 7:106882447-106882469 AGATGGAGAAGGAAAGAGGAGGG - Intronic
1030489935 7:110219661-110219683 ATCCGGAACAGGAACTAGGAAGG - Intergenic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031816436 7:126443469-126443491 ATCTGGAGTAGGATTGTGGAAGG + Intronic
1031996495 7:128235356-128235378 AGCTGGAGTAGGAAAGAAGGCGG - Intergenic
1032929089 7:136644944-136644966 AGTTGGAATTGGAAAGATGAAGG + Intergenic
1033049006 7:137987283-137987305 ATCTGTAACTGGAAAGAGGGAGG + Intronic
1033470617 7:141645596-141645618 ATCAGAAATAAGAAAGACGATGG - Intronic
1034035030 7:147810545-147810567 TTCTGGAACATGAAAGAGGTTGG - Intronic
1034061970 7:148100218-148100240 AAAAGGAAAAGGAAAGAGGAAGG - Intronic
1035293176 7:157853059-157853081 ATCTGGAGGCGGAGAGAGGACGG - Intronic
1035348674 7:158227165-158227187 ATCTGTCAAAGTAAAGAGGATGG + Intronic
1037275212 8:17171125-17171147 ATCTGGAATTGGAAAGGAGGGGG + Intronic
1037312169 8:17567851-17567873 ATCTGGAATGGAGAAGAGGTAGG + Exonic
1037471179 8:19212605-19212627 AGCTGTAAGAGGAAAGAGAAAGG - Intergenic
1037522601 8:19694637-19694659 TTCTAGAATAGGAAAGGGCATGG + Intronic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038395824 8:27244730-27244752 ATCAGAAAGTGGAAAGAGGAGGG + Intronic
1038725218 8:30076206-30076228 ATCTGGCATAGTAAAGGGCATGG + Intronic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1040684635 8:49857173-49857195 ATCTGGGACAGAAAGGAGGATGG + Intergenic
1041198383 8:55424835-55424857 ATCTGCAATAGGCAACAGGGTGG - Intronic
1041317778 8:56582217-56582239 ATCAGGAATAGGAAATGGAAGGG + Intergenic
1042326387 8:67533147-67533169 ATCTGGAATGGGACAGCAGAGGG + Intronic
1042444142 8:68863862-68863884 ATCTGGGAAAGAAAAGAGAAGGG - Intergenic
1042491499 8:69404082-69404104 GTCTGGGATAGGAAAGTGTAAGG - Intergenic
1042651400 8:71045892-71045914 AGCTGCAGAAGGAAAGAGGAAGG + Intergenic
1043082794 8:75786236-75786258 AACTGAAAAAGGAAAGAGGGAGG + Intergenic
1044265770 8:90179407-90179429 AGGTTGAATAGGAGAGAGGAGGG + Intergenic
1045683638 8:104688961-104688983 ATCTAGAAAAGGAAAGAAAAAGG - Intronic
1045784518 8:105904732-105904754 ATCTGCAAGAGGAGAGAGAAGGG - Intergenic
1046394199 8:113618696-113618718 CTCTTGAAAATGAAAGAGGAGGG + Intergenic
1046774092 8:118145703-118145725 ATCTGTCAAAGGAAAGAGGGAGG + Intergenic
1047148773 8:122237061-122237083 ATCATGAATAGGAAAGTGGATGG + Intergenic
1047395951 8:124499111-124499133 ATCTGTAATAGCAAAGAAAAAGG - Intronic
1047695546 8:127400296-127400318 AGGTTGAATAGTAAAGAGGAGGG + Intergenic
1047902282 8:129436378-129436400 ATCTGGAAAAGGCAAGAAAATGG + Intergenic
1048254549 8:132895934-132895956 AGCTTGTAGAGGAAAGAGGAAGG + Intronic
1050124102 9:2338608-2338630 AGCTCGAATAGGAATTAGGATGG + Intergenic
1050163219 9:2739233-2739255 ATGAGGAACAGCAAAGAGGAAGG + Intronic
1050242815 9:3656517-3656539 ATCTGGAATTGAAAGGATGAAGG - Intergenic
1050247914 9:3710884-3710906 ACCTATAATAGGAAAGAAGAAGG + Intergenic
1050526714 9:6552790-6552812 ATTTGGAATAAGACAAAGGAAGG + Intronic
1050945568 9:11512070-11512092 TTCTGGGATAGGAAAGATGGTGG - Intergenic
1051231047 9:14955987-14956009 AAATGTTATAGGAAAGAGGAAGG + Intergenic
1051594647 9:18812126-18812148 AACTAGAATAGCAAAGAGGCAGG + Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1053184604 9:36004679-36004701 ATCTAGAATGGGACAGAGGGTGG - Intergenic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1056471334 9:86906876-86906898 ATCTGGAACAGAAAAGATGTTGG - Intergenic
1057516612 9:95727280-95727302 ACCAGGAAGAGGAAAGAGAAGGG - Intergenic
1057535066 9:95893942-95893964 ATCTGTATTAGGAAAGAAGAGGG - Intronic
1058257425 9:102785573-102785595 ATCTGGAAGTGGCAACAGGAAGG - Intergenic
1058563218 9:106251399-106251421 ATCTGAAATAGGATTGAGAAAGG + Intergenic
1059762881 9:117355773-117355795 ATCTGGAATTGGAAAGCTGGAGG + Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1061224162 9:129271016-129271038 ATCTTCAAAAGGAAACAGGAGGG - Intergenic
1061905732 9:133695965-133695987 TTCTGGAAGAGTAGAGAGGAAGG + Intronic
1186410801 X:9342893-9342915 CTCTGAAACAGGAAAGGGGACGG + Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187215222 X:17269355-17269377 ATCCGAAAAAGGGAAGAGGAAGG + Intergenic
1187419920 X:19125251-19125273 CTATGGAAGAGGAAAGAGGTTGG + Intergenic
1188347126 X:29080541-29080563 ATCTGAAGCAGGAAAGAGGAAGG + Intronic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188485567 X:30677973-30677995 ATCTGCAAGAGGAGAGAGCATGG - Intronic
1188983720 X:36751123-36751145 ATCAGCAATAGGAGTGAGGATGG - Intergenic
1190144647 X:47879277-47879299 TTCTGGAAAAGGAAAGATGAGGG - Intronic
1190456563 X:50633757-50633779 GTCTGCAAAAGGCAAGAGGATGG + Exonic
1190614646 X:52217704-52217726 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1191696184 X:63993263-63993285 TTCTGGAATGGAGAAGAGGAGGG - Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192187675 X:68963046-68963068 TTCTGGAAAAGGAAAAAGTATGG - Intergenic
1192312198 X:70026368-70026390 GACTGGAATATGAAATAGGAGGG + Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1195706935 X:107743894-107743916 ATCTGGACTGGGAAGGAGCAAGG - Intronic
1197280786 X:124533487-124533509 CTCTGGAAGAGGAAACAGGGAGG - Intronic
1197438028 X:126456353-126456375 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1197524420 X:127544892-127544914 CTCTGCCATTGGAAAGAGGAGGG - Intergenic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198056651 X:133002313-133002335 AAGAGGGATAGGAAAGAGGAGGG + Intergenic
1200023119 X:153228441-153228463 ATCAGGAATAGGAAACAGATAGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic