ID: 1148312026

View in Genome Browser
Species Human (GRCh38)
Location 17:46653141-46653163
Sequence AGAATCTAAGAGGATCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148312026_1148312030 4 Left 1148312026 17:46653141-46653163 CCATGTAGATCCTCTTAGATTCT 0: 2
1: 0
2: 0
3: 14
4: 175
Right 1148312030 17:46653168-46653190 TTAGGAAAGACCTCTTGGATTGG 0: 2
1: 0
2: 1
3: 17
4: 169
1148312026_1148312029 -1 Left 1148312026 17:46653141-46653163 CCATGTAGATCCTCTTAGATTCT 0: 2
1: 0
2: 0
3: 14
4: 175
Right 1148312029 17:46653163-46653185 TGAATTTAGGAAAGACCTCTTGG 0: 2
1: 0
2: 2
3: 23
4: 211
1148312026_1148312032 14 Left 1148312026 17:46653141-46653163 CCATGTAGATCCTCTTAGATTCT 0: 2
1: 0
2: 0
3: 14
4: 175
Right 1148312032 17:46653178-46653200 CCTCTTGGATTGGTCCTGAATGG 0: 2
1: 0
2: 0
3: 9
4: 93
1148312026_1148312033 21 Left 1148312026 17:46653141-46653163 CCATGTAGATCCTCTTAGATTCT 0: 2
1: 0
2: 0
3: 14
4: 175
Right 1148312033 17:46653185-46653207 GATTGGTCCTGAATGGCACTAGG 0: 2
1: 0
2: 1
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148312026 Original CRISPR AGAATCTAAGAGGATCTACA TGG (reversed) Intronic
901134321 1:6983178-6983200 AGAATCTAAGAGTATGTGCGGGG + Intronic
901137231 1:7005870-7005892 AGAATCCAAGTGGCTCAACAGGG + Intronic
901779335 1:11583041-11583063 AGTATCAAAGAGGATCTTCTTGG + Intergenic
902190512 1:14759815-14759837 GGGATCTAAGAGGATCTGGACGG - Intronic
905980030 1:42216654-42216676 AAGAACAAAGAGGATCTACATGG + Intronic
907465756 1:54635484-54635506 AGAATAAAAGAGTATCTAGAAGG + Exonic
909469119 1:76006893-76006915 CGAATCTAACAGGATTTCCAAGG - Intergenic
909914548 1:81301165-81301187 AGAATCTAAAAGGATCTTGCTGG - Intergenic
910380035 1:86616482-86616504 AGAATCTGAGAGATTCTACCAGG + Intergenic
910437002 1:87215539-87215561 AGAATCTATGAGGAGCTTTATGG - Intergenic
911046510 1:93633284-93633306 AGATTCTAACAGGATGTAAATGG - Intronic
912228880 1:107769220-107769242 AGAAGGTAAGGGGATTTACAGGG - Intronic
914879170 1:151534652-151534674 AGAGGCTAAGAGTATGTACATGG - Intronic
916400743 1:164445958-164445980 AGATTCTCAGAGGATCTGGAGGG - Intergenic
919754603 1:201058944-201058966 AGAATGTAAGAGAAGCTCCAAGG + Intronic
923278901 1:232422739-232422761 AGAAACTAAGAGAAACTACTGGG + Intronic
923484505 1:234416005-234416027 AGATTCGAAGAGAATATACAAGG + Intronic
1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG + Intronic
1069212052 10:65773711-65773733 AGAATCTAATAGAATTTTCAAGG + Intergenic
1071239545 10:83689858-83689880 AGTATCAAAAAGGATCTAGATGG + Intergenic
1072445717 10:95497038-95497060 AGATTGTGAGAGGGTCTACAAGG - Intronic
1073425701 10:103454394-103454416 AGAGGCTAAGAGGAGCTCCAAGG - Exonic
1076378033 10:130004622-130004644 AGAATCTCACAGGACCGACAGGG - Intergenic
1079288013 11:19157311-19157333 AGAATCTAAAGGGAAATACAGGG + Intronic
1080443982 11:32320707-32320729 AGAATTGAAGAGGATTTACATGG - Intergenic
1080913558 11:36630659-36630681 AAAATCAAAGATGTTCTACAAGG - Intronic
1083076656 11:60046790-60046812 AGAGTCCACGAGGATCTAGAAGG + Intronic
1084362314 11:68677017-68677039 AGATTCTAAGAGGCTGTAAACGG + Intergenic
1085659149 11:78346929-78346951 AGCATCTAAGAGAATCCAGAAGG + Intronic
1086531339 11:87789341-87789363 AAAATCTAAGAGGCTCGGCATGG + Intergenic
1086670559 11:89541105-89541127 AGAATTTAAGAGGATTTTGAGGG - Intergenic
1086881038 11:92153605-92153627 AGATTCTATGAGGATCAATAAGG + Intergenic
1088465318 11:110129384-110129406 ACAAAATAAGAAGATCTACATGG - Intronic
1094084168 12:26571201-26571223 AAAATCTAACATGATATACATGG + Intronic
1096013896 12:48248527-48248549 AGAATCTCAGAGAATGTACCAGG + Intergenic
1101196815 12:102392089-102392111 ACTATCTAAGAGAATCTACTTGG + Intergenic
1101752683 12:107595597-107595619 AGAATCTAAGAGAATGTGGAAGG + Intronic
1101799242 12:108006235-108006257 AGAATCTGACAGAAGCTACATGG - Intergenic
1107147950 13:37079769-37079791 AGCATTTGAGAGGATGTACAAGG + Intergenic
1108572225 13:51763147-51763169 AGAATCTAAAAGAATGTTCAAGG + Exonic
1110594139 13:77300124-77300146 AGCATTTTAGAGGATTTACAAGG - Intronic
1110720017 13:78750935-78750957 AGATTCTAAGAGCAACCACAGGG + Intergenic
1110883529 13:80603355-80603377 AGAATTTGAGATGATGTACAAGG + Intergenic
1112852289 13:103721101-103721123 ATTATCTAAGAGGTTATACATGG + Intergenic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1115639572 14:35324805-35324827 AAAATCTAAGAGGCTTCACAAGG + Intergenic
1116166904 14:41345452-41345474 AGAAACTAAAAGAATTTACAAGG + Intergenic
1116172623 14:41422609-41422631 AGAATGTAAGAGGAAATACTAGG + Intergenic
1116432650 14:44865050-44865072 AGAATCGAAAAGGTGCTACAGGG - Intergenic
1116980402 14:51164023-51164045 AGAATCTGAGAGGAGATTCACGG + Intergenic
1117872732 14:60217860-60217882 AGACTCTAAGAGCTTCTAAAAGG - Intergenic
1119742426 14:77022870-77022892 AGCATCTTAGAGGATCTTCCAGG + Intergenic
1121165483 14:91792257-91792279 AGAATATTAGAGGATCTGGAAGG - Intronic
1122406806 14:101505651-101505673 AGAGTCTCAGAGGATCTAGCAGG + Intergenic
1129945190 15:79533608-79533630 AGCATCTAAGCAGATCTGCATGG + Intergenic
1130166521 15:81466422-81466444 AGAATCTAGGAAGAACTGCATGG - Intergenic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1132297122 15:100747187-100747209 AGAATCTTAGAATATCTAAAAGG - Intergenic
1132459562 16:44341-44363 AAAATCTCAGAGGTTCTCCAGGG + Intergenic
1136638612 16:31542558-31542580 AGAATAAAAAAGGATCTAGAAGG + Intergenic
1138515778 16:57535027-57535049 AGGCTCTGGGAGGATCTACAGGG - Intronic
1138824915 16:60307528-60307550 AGCCTTTAAGAGAATCTACAAGG - Intergenic
1139335019 16:66225705-66225727 AGAATCTAACAAGATCCCCAGGG + Intergenic
1139383405 16:66548850-66548872 AAAATACAAGAGGATCTCCAGGG - Intronic
1144150961 17:12445337-12445359 AAAACATAAGAGAATCTACATGG + Intergenic
1144614773 17:16758739-16758761 AGGACCTAAGAGCTTCTACAGGG - Intronic
1144897932 17:18556935-18556957 AGGACCTAAGAGCTTCTACAGGG + Intergenic
1145134437 17:20388779-20388801 AGGACCTAAGAGGTTCTACAGGG - Intergenic
1146383804 17:32351331-32351353 AGAATCTAAGAGTAACTATATGG - Intronic
1147209778 17:38865921-38865943 AAAATCTAAGAGGGTCTGCCAGG - Intergenic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1150185070 17:63171802-63171824 AGTACCAAAGAGGATTTACAGGG - Intronic
1151258764 17:72900419-72900441 AGGATGTATGAGGATCTGCAAGG + Intronic
1153135911 18:1917525-1917547 AGAACCTAAGAGACTCAACAAGG + Intergenic
1154100936 18:11472928-11472950 AGATTCTAAGAGTATGTCCATGG + Intergenic
1160133919 18:76255181-76255203 AGAATCTACGAGGAACTCAAAGG + Intergenic
1160474423 18:79169268-79169290 AGAAAATAAGAGGTTCTAGAAGG - Intronic
1164460354 19:28442278-28442300 AGAATGTGAAAGGATCTGCAAGG - Intergenic
1164925143 19:32124490-32124512 AGAGACTGAGAGGAGCTACAGGG + Intergenic
1168573165 19:57487372-57487394 GGAATTGAAGAGGATCTTCAGGG - Intergenic
925357078 2:3249553-3249575 AGAAGCAAAGAGGATTTTCAGGG + Intronic
929585311 2:43110221-43110243 AGAATCTTAGAGGCTCTAGTAGG - Intergenic
930043710 2:47150139-47150161 AGCAACTAAGAGAATATACATGG + Intronic
932285533 2:70528766-70528788 AGAACCTAAGAGTTACTACAAGG + Intronic
938997109 2:136691745-136691767 AGACTCCAAGAGGATATAGATGG + Intergenic
939450755 2:142371052-142371074 TGAATCTAAGAGCATATACATGG + Intergenic
940219198 2:151334233-151334255 ACAATCTAAGAGGATGTCAATGG - Intergenic
940474099 2:154138342-154138364 AGAATGTAAGAGGATAAAGAAGG + Intronic
941011892 2:160309353-160309375 AAAATCTAAGGGAATCTTCAAGG + Intronic
943376909 2:187089136-187089158 AGAATCAAAGATCATCTATAAGG + Intergenic
946044146 2:216807194-216807216 GGAAGGTAAGAGGATCTACAAGG - Intergenic
1171276735 20:23862616-23862638 AGAATCTTCAAGGAACTACAAGG - Intergenic
1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG + Intergenic
1173233669 20:41223676-41223698 AGAATTTAAAAGGGGCTACAGGG - Intronic
1177160239 21:17539366-17539388 AGATTCTCAGGGGATCTACAAGG + Intronic
1177199737 21:17940991-17941013 AGAATTTAAGAGAATTTTCAAGG + Intronic
1179069562 21:38059026-38059048 AGAATCAAGGAGGAGCTAGAAGG - Intronic
1179370377 21:40801228-40801250 AAAATATAAAAGGAGCTACATGG + Intronic
1181895999 22:26107947-26107969 AGAATCTGTGAGCATCTAAATGG + Intergenic
1184922124 22:47613184-47613206 CGAGTCTATGAGGATCTGCAAGG + Intergenic
949122224 3:400511-400533 AGCAACTAAGAGAATCTACTAGG + Intronic
950087261 3:10269009-10269031 AAAATCTGAAAGGAACTACATGG - Intronic
951009596 3:17661167-17661189 AGATGCTAAGAGACTCTACAAGG + Intronic
951428853 3:22582980-22583002 AGAATCCAAGAGCATCTAAGTGG + Intergenic
957137955 3:76313561-76313583 AGAGGCAAAGAGGATCAACATGG + Intronic
957245217 3:77707861-77707883 AGCATTCAGGAGGATCTACAGGG - Intergenic
957281118 3:78152927-78152949 ATAGTCTAAGAGGATTTTCATGG - Intergenic
957414864 3:79888475-79888497 AGAAACAAAGAGGAACTAGATGG - Intergenic
957970980 3:87381507-87381529 AGATTCTAAGAGTCTCTCCAAGG - Intergenic
961488811 3:127236638-127236660 AAAATCTAACAGATTCTACAAGG - Intergenic
962868302 3:139466121-139466143 AGAATCTATGAAATTCTACAGGG - Intronic
964828660 3:160858711-160858733 AAAATTCAAGAGTATCTACATGG + Intronic
970609690 4:17713585-17713607 ACAATCTCAGAGGATCCTCATGG + Intronic
971031013 4:22636796-22636818 AGAATGTCAGAGGATGTGCAAGG - Intergenic
973755764 4:54071935-54071957 AGAATCTAAGAGAAACAACATGG - Intronic
979280997 4:118867442-118867464 AGAAACTAATAGGAACCACAAGG - Intronic
980022355 4:127724632-127724654 AACCTCTAGGAGGATCTACAGGG - Exonic
980856096 4:138442367-138442389 AAAATGTAAGAGGATCAATAAGG + Intergenic
982284880 4:153724475-153724497 AGACTCCAAGAGGATGTGCAGGG - Intronic
982887026 4:160794536-160794558 AGGATCTAGGAGCATGTACATGG + Intergenic
987683044 5:21162347-21162369 TGAATCTCAGAGCATTTACACGG + Intergenic
988813819 5:34811845-34811867 TGTATCCAAGAGAATCTACAAGG - Exonic
989564624 5:42889760-42889782 AGCATATGAGAGGATCTGCATGG + Intergenic
996407737 5:123122988-123123010 AGAATCTATAAGAATCTATAAGG - Intronic
997643323 5:135464050-135464072 AGAATCTAAAAGGCCCTGCAAGG - Intergenic
999837364 5:155388846-155388868 AGATTCTAAGAGACTCCACAGGG + Intergenic
1000383784 5:160654335-160654357 ATAATCTAAGAAAAACTACAGGG - Intronic
1000700101 5:164438694-164438716 TGAGTATAAGTGGATCTACATGG + Intergenic
1003453376 6:6258447-6258469 AGCATATAAGAGACTCTACAAGG + Intronic
1004090186 6:12493573-12493595 AGAATTTAAAAAGATCTACTAGG + Intergenic
1005390198 6:25324974-25324996 AGGACCTAAGAGGCTCTGCATGG - Intronic
1008138041 6:47799863-47799885 AGAAATTTAGAGGATGTACATGG - Intronic
1010880318 6:81160104-81160126 ATATTCAAAGAGGATCAACAGGG - Intergenic
1011605598 6:89102118-89102140 AAAATTGAAGAGGCTCTACATGG - Intronic
1012848871 6:104423901-104423923 AGAATGTAAGAGGATATGCAGGG - Intergenic
1013406575 6:109849182-109849204 AGAATCTAAGAGGCTGTCCAAGG - Intergenic
1014476817 6:121883449-121883471 AGTAGCCAAGAGGATTTACACGG - Intergenic
1015172248 6:130266613-130266635 GGACTCTGGGAGGATCTACATGG - Intronic
1017464164 6:154679077-154679099 AGGATCTGAGAAGATCTAGAAGG + Intergenic
1021638408 7:22714004-22714026 AGAATCTCAGAGGATTTAAACGG + Intergenic
1021955761 7:25823073-25823095 AGAATCACAGAAGATCCACATGG + Intergenic
1022197409 7:28082444-28082466 AGAACCTAAGAAGATCCCCAAGG - Intronic
1023273035 7:38487128-38487150 AGATACTATGAGGTTCTACATGG + Intronic
1023560940 7:41472710-41472732 AGAATCTAATAGGATCTTCCAGG + Intergenic
1024349417 7:48348331-48348353 ACAATCAAAGAGGAGCTAGAAGG - Intronic
1025598678 7:62966173-62966195 AGAATCTGAGAAGAGATACAAGG + Intergenic
1026326572 7:69315636-69315658 TGAATCCCAGAGGATCTAAATGG - Intergenic
1026342272 7:69444781-69444803 AGAATCTAAGAGGCTAGGCATGG - Intergenic
1026765619 7:73157704-73157726 ACAATCTAAGGGGTTCTACCTGG - Intergenic
1027042092 7:74967397-74967419 ACAATCTAAGGGGTTCTACCTGG - Intronic
1027081549 7:75234957-75234979 ACAATCTAAGGGGTTCTACCTGG + Intergenic
1027467878 7:78537714-78537736 AGAATCTACAAGGAACTACAAGG - Intronic
1029390137 7:100269542-100269564 AGAATCTAAGGGGTTCTACCTGG + Intronic
1030100737 7:105943093-105943115 AGAATCAAAGAGGATCATCTGGG - Intronic
1030593715 7:111511186-111511208 AAAATATAGGAGGATCTGCAAGG + Intronic
1030825661 7:114154833-114154855 AGAATCTCAGAGGGTATAAATGG - Intronic
1032737064 7:134702250-134702272 AGATGCTGAGAGGAGCTACAAGG + Intergenic
1037208732 8:16358594-16358616 AGAATCTATGAACATGTACAGGG - Intronic
1042513836 8:69639392-69639414 AAAATATAAGAGGATCTGAATGG + Intronic
1043848989 8:85194371-85194393 AGAATCTACTAGAATGTACATGG - Intronic
1044071949 8:87772037-87772059 AGAAGGAAAGAGGTTCTACATGG - Intergenic
1044136652 8:88594291-88594313 AGATTCAAAGAGGTTCTTCAAGG + Intergenic
1047025726 8:120821926-120821948 ATCATCAAAGAGGAACTACAAGG + Intergenic
1051785994 9:20744189-20744211 AGTTTCTAAGAGGATGTTCAAGG - Intronic
1056327098 9:85489140-85489162 AGAATCGAAAAGGACCCACAAGG + Intergenic
1057719823 9:97523101-97523123 AGTATCCAAGAAGATCTTCAAGG + Intronic
1059718671 9:116937232-116937254 ATAATCTAAGAGGCTCTTCATGG + Intronic
1185696652 X:2200004-2200026 AGAATCAAAGAGTATCTTCCAGG + Intergenic
1186472882 X:9835012-9835034 AGAATCAATGAGGATGAACAGGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188066807 X:25671798-25671820 AGATTTTAAGTAGATCTACACGG - Intergenic
1188259346 X:28004080-28004102 AAAATCTATGAGGATTTCCAGGG + Intergenic
1188984494 X:36757053-36757075 AGAAACCAACAGGATCTGCATGG - Intergenic
1189550386 X:42086614-42086636 AGAAGTTATGAGTATCTACAGGG - Intergenic
1193633436 X:83918545-83918567 AGAATTGAAGAAAATCTACAGGG + Intergenic
1194124723 X:90002019-90002041 ATAATATATGAGGATCTGCAAGG - Intergenic
1194125959 X:90017084-90017106 AGAATCTAAAATGATCTCAAAGG + Intergenic
1194361756 X:92960864-92960886 AGAATCAAAGATGATCTCTAAGG + Intergenic
1196027829 X:111060741-111060763 AGAATGCAAGACGGTCTACAAGG - Intronic
1196327983 X:114431118-114431140 AAAATCTAAGAACATTTACAAGG + Intergenic
1196472160 X:116040630-116040652 AGAATGAAAAAGGATCTAGAAGG + Intergenic
1196818247 X:119682382-119682404 AGAGTCTGAGAGGAGCTAAAAGG + Intronic
1197994695 X:132360732-132360754 AGAATATATGAAGATCTTCAGGG - Intergenic
1198079520 X:133226016-133226038 AGAATCTAAGAGGACTAAAATGG + Intergenic
1198195402 X:134355695-134355717 AAAATCTAATAGGATATCCAAGG + Intergenic
1199327696 X:146519718-146519740 AGAATGTAAGGGGAACTAAATGG - Intergenic
1200477615 Y:3659629-3659651 ATAATATATGAGGATCTGCAAGG - Intergenic
1200775819 Y:7169438-7169460 AGCATCTAAGTGTATATACAGGG - Intergenic
1200925921 Y:8654537-8654559 AGAATCCAAAAAGATCTGCAGGG + Intergenic
1200932037 Y:8705893-8705915 AGGATCTGAGAAGATCTGCAGGG - Intergenic