ID: 1148313699

View in Genome Browser
Species Human (GRCh38)
Location 17:46672945-46672967
Sequence AAGCCTTGAGCTTCTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 0, 2: 4, 3: 10, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148313699_1148313702 11 Left 1148313699 17:46672945-46672967 CCTCTAGGAGAAGCTCAAGGCTT 0: 2
1: 0
2: 4
3: 10
4: 132
Right 1148313702 17:46672979-46673001 TCCCTACCACTCATACTTGGAGG 0: 2
1: 0
2: 0
3: 6
4: 67
1148313699_1148313701 8 Left 1148313699 17:46672945-46672967 CCTCTAGGAGAAGCTCAAGGCTT 0: 2
1: 0
2: 4
3: 10
4: 132
Right 1148313701 17:46672976-46672998 ATCTCCCTACCACTCATACTTGG 0: 2
1: 0
2: 1
3: 8
4: 84
1148313699_1148313704 12 Left 1148313699 17:46672945-46672967 CCTCTAGGAGAAGCTCAAGGCTT 0: 2
1: 0
2: 4
3: 10
4: 132
Right 1148313704 17:46672980-46673002 CCCTACCACTCATACTTGGAGGG 0: 2
1: 0
2: 0
3: 2
4: 85
1148313699_1148313707 23 Left 1148313699 17:46672945-46672967 CCTCTAGGAGAAGCTCAAGGCTT 0: 2
1: 0
2: 4
3: 10
4: 132
Right 1148313707 17:46672991-46673013 ATACTTGGAGGGTGAGTCAAAGG 0: 2
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148313699 Original CRISPR AAGCCTTGAGCTTCTCCTAG AGG (reversed) Intronic