ID: 1148315397

View in Genome Browser
Species Human (GRCh38)
Location 17:46692956-46692978
Sequence CTGCAAGCAGAGAGGGAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 2, 1: 0, 2: 3, 3: 71, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148315397 Original CRISPR CTGCAAGCAGAGAGGGAGCA TGG Exonic
900174584 1:1286143-1286165 CTGCCAGCAGAGCGCGACCAGGG - Exonic
900457300 1:2783517-2783539 CCCCAAGGAGAGAGGGAGCCGGG - Intronic
900473281 1:2864778-2864800 CGGCCATCAGAGAGGGCGCACGG - Intergenic
900767441 1:4514592-4514614 GTGCAGGTAGAGAGGGAACAGGG - Intergenic
900929977 1:5730279-5730301 GAGCAGGGAGAGAGGGAGCAAGG + Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901742326 1:11350381-11350403 CTGGAAGCAGAGAGGGGGTCCGG - Intergenic
901917419 1:12510567-12510589 GTGCATGCAGAGAGGAAGGAAGG + Exonic
902068688 1:13712954-13712976 GGGGAAGCAGAGAGGGAGCCAGG - Intronic
902219880 1:14958088-14958110 GAGCAGGCAGAGGGGGAGCAGGG - Intronic
902255815 1:15187930-15187952 GTGCAAGCTGAGAGGATGCATGG + Intronic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
903806160 1:26007038-26007060 CAGGAAGCAGACAGGGAGAAGGG - Intergenic
903924615 1:26823135-26823157 CTGCTAGCAGATAGGAAGGAGGG + Intergenic
904042640 1:27593341-27593363 CTGCAGGGAGAGAGGGAGAGAGG - Intronic
904280178 1:29413463-29413485 CAGCAAGTAGAAAGGGAGCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
905908906 1:41640411-41640433 TTGCACCCAGAGAGGGAACACGG - Intronic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906059175 1:42937128-42937150 GAGCAAGCACAGTGGGAGCAGGG - Intronic
906210718 1:44010989-44011011 CTGCCAGCAGAGGGGAAGCCCGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906701844 1:47865220-47865242 CTGCAAGCGGAGAGGAGGCCTGG - Intronic
907334413 1:53690973-53690995 CAGCTAGCAGTGAAGGAGCAGGG + Intronic
907536023 1:55158100-55158122 ATGCAGGTAGAGAGGCAGCAAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
910017157 1:82539803-82539825 CTGCACTCTGACAGGGAGCATGG - Intergenic
910053859 1:83008473-83008495 GTGGAAGGAGAGAGGGAGGAAGG - Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
910819978 1:91336061-91336083 TTGCAAGAAGGGAGGGAGGAGGG - Intronic
910853974 1:91676288-91676310 CATCAAGCAGATAGGGAGCTAGG - Intergenic
911265912 1:95742972-95742994 CTGCAGGCTGCGTGGGAGCAGGG - Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
915079185 1:153339929-153339951 CTAGAAGCAGAGAAGCAGCACGG + Intronic
915848205 1:159291630-159291652 CAGTAAGCAGAGAGGGAATAAGG - Intronic
915884614 1:159709449-159709471 CTGCAAGCTTAGTGGGAGCCAGG + Intergenic
916900307 1:169215169-169215191 CTTCAAGGAGAGAGGGAGAGAGG - Intronic
917155923 1:171998952-171998974 CTGCAATCAGAGAGGTAGGCAGG + Intronic
917453817 1:175168911-175168933 GAGCAAGCAGAGAGAGAACAGGG - Intronic
917676251 1:177321862-177321884 TTTAAATCAGAGAGGGAGCAGGG - Intergenic
917968008 1:180190635-180190657 CTCCAAGGGGAGAGGGGGCAGGG + Intronic
918144310 1:181742249-181742271 CTGCCAGCAGAGAGAGGGCCTGG + Intronic
918168179 1:181970476-181970498 CTGCACCCAGAAAGGGAACAAGG - Intergenic
918210965 1:182350310-182350332 CTGAATGCAGAGAGGTTGCATGG + Intergenic
918679170 1:187329844-187329866 CTGGAAGCAGAGGGTTAGCAGGG + Intergenic
919116826 1:193290451-193290473 ATGAAATCAGAGAGGGAGTAGGG + Intergenic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
920667326 1:207972570-207972592 CTCCAAACAGAGAGGGAGTGGGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921996021 1:221419245-221419267 CTGGAAGTAGAGAGTGAGAAAGG - Intergenic
923096374 1:230778339-230778361 GTGGAAGCAGAGAGGCAGCTAGG - Intronic
923504215 1:234591536-234591558 CTGCCAGAAGTGAGGTAGCAAGG - Intergenic
924668655 1:246100520-246100542 CAGCAAGCAGTCAGGGAGGAGGG - Intronic
924676592 1:246184711-246184733 ATGCAAGCACACAGGGAGGAAGG - Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063758576 10:9044881-9044903 CTGTCAGCAGAGAGTGAACATGG + Intergenic
1064184177 10:13146473-13146495 ATGCACACAGAGAGGGAGGAAGG - Intergenic
1064565517 10:16635382-16635404 CAGCTAGCTGAGAGGGAGGATGG - Intronic
1065024303 10:21526319-21526341 CTGCGAGCAGAGAGAGGGCGCGG - Intergenic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1067161078 10:43825690-43825712 CTGCGAGCTGCGAGGGAGCCCGG - Intergenic
1067191812 10:44076853-44076875 CTAGAAGAAGAGAGGGATCATGG - Intergenic
1067411646 10:46069800-46069822 CTCCATCCAGAGGGGGAGCAGGG - Intergenic
1069213474 10:65790815-65790837 CTGCAGGCAAAGAGAGAGCTTGG - Intergenic
1070004293 10:72408038-72408060 CTGCAAGAGGAGAGACAGCAAGG + Intronic
1070564189 10:77591030-77591052 GTGCCAGCAGACAGCGAGCAAGG + Intronic
1070745760 10:78932803-78932825 ATGGAAGCAGAGAGAGATCAGGG + Intergenic
1071299455 10:84245367-84245389 CTGGGAGCAGAGAGGAAGCCAGG + Intronic
1071481553 10:86068838-86068860 CTGCCAGCAGAGAGGGCACTTGG - Intronic
1071834835 10:89408611-89408633 TTTAAATCAGAGAGGGAGCAGGG - Intronic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1073150866 10:101310587-101310609 CAGGAACCAGAGAGGGAGCCGGG - Intergenic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1074123455 10:110510147-110510169 CATCAAGCAGAGGAGGAGCATGG + Exonic
1074620008 10:115108719-115108741 CTGCAAGCTGAGAGCTTGCATGG - Intronic
1075208313 10:120466227-120466249 CTGCAGGCAGATGGGCAGCATGG + Intronic
1075586402 10:123661430-123661452 CTGCAAGTGGAGTGGGACCAGGG - Intergenic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1077141737 11:1027818-1027840 CTGCGGGCAGAGAGCCAGCATGG + Intronic
1077247069 11:1544827-1544849 CAGGAAGCAGTGAAGGAGCAGGG + Intergenic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078159507 11:8828552-8828574 GAGGAAGCAGAGAGGGATCATGG - Intronic
1078159955 11:8831813-8831835 CTGCAAGCAGAAAGGGCCCAAGG - Intronic
1078405705 11:11068245-11068267 CAGCAGGCAGCCAGGGAGCATGG - Intergenic
1079205817 11:18413412-18413434 CCAAAAGCAGAGAGGGAGGAGGG - Intronic
1079387452 11:19993330-19993352 CTGCAAGAAGAAAGAGAGCATGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080245913 11:30178838-30178860 CTGCAAGGAGACAGCGAGGATGG + Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080592880 11:33738770-33738792 GGGCAAGCAGAGAAGGGGCAGGG - Intergenic
1081102664 11:39024444-39024466 AGGCAAGCAGGGAGGGAGGAAGG - Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081667160 11:44923327-44923349 CACCCAGCAGAGAGGGAGGATGG + Intronic
1081719051 11:45273316-45273338 CACCTAGCAGGGAGGGAGCAGGG + Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083397503 11:62401723-62401745 CTGCAGGAAGAGAGAGGGCAGGG + Intergenic
1083404831 11:62449390-62449412 CTGAAACCAGAGAGGGAGGCAGG + Intronic
1083920383 11:65779092-65779114 CTGGAAGCAGAGAGTGGCCAAGG + Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1083968750 11:66059393-66059415 ATGCATCCAGAGAGGGACCATGG + Intronic
1084101207 11:66950929-66950951 GAGCAAGCAGAGAGAGAACAAGG + Intronic
1084212343 11:67630005-67630027 CCGAAAGCTGAGAGGGAGAAGGG + Intergenic
1084421889 11:69064396-69064418 CTGCAGTCAGAGAGGGTACAGGG - Intronic
1084534149 11:69746926-69746948 CAGCAAGCAGAGAGGGAAGGTGG - Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1086053794 11:82624818-82624840 CTGCAAGCTGAGGAGGAGCAAGG - Intergenic
1088837423 11:113589666-113589688 AGGAAAGCAGGGAGGGAGCAAGG + Intergenic
1088878148 11:113952667-113952689 CTGCAAGCCGAGACTGGGCAGGG - Intergenic
1089139038 11:116271819-116271841 CTGGTATCAGAGAGGGGGCAGGG - Intergenic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1089216487 11:116837461-116837483 CTGCAATGAGTGGGGGAGCACGG - Intronic
1089539484 11:119181411-119181433 CTGCAAGCAGCAGGGCAGCAGGG + Intronic
1090114030 11:123947244-123947266 CTGCAAACTGAGAGGTAACAAGG - Intergenic
1090756117 11:129793272-129793294 ATGCAAGCACAAAGGTAGCAAGG + Intergenic
1091427095 12:400578-400600 AGGCAAGAAGAGAGGGAGAAAGG + Intronic
1092109164 12:5946597-5946619 CTGGAAGTAGACAGGGAGAAAGG - Intergenic
1092193801 12:6537286-6537308 CTGCAAAGAAAGAGGGAGCGGGG - Intronic
1092218419 12:6697793-6697815 CTGCAAGAAGGGAGAGAGCGTGG + Intronic
1092777134 12:11953544-11953566 CAGCCAGCAGAGACGGGGCAGGG - Intergenic
1094031056 12:26011441-26011463 CTGCAGGCAGGGAGGAAGCAAGG - Intronic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1096504609 12:52084855-52084877 CTGGAAGTAGAGAGGAGGCAAGG + Intergenic
1096616684 12:52837055-52837077 TTGGAAGCAGGGAGGGAGCTGGG - Intergenic
1096749872 12:53751875-53751897 CCGCAAGGAGAGAGGGAGCGGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1100310556 12:93391093-93391115 CTGGCAGCAGGGAGGGAGCAGGG + Intronic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1101320048 12:103665592-103665614 ACCAAAGCAGAGAGGGAGCAGGG + Intronic
1101525437 12:105524209-105524231 CTTCAAGCAGAGAAGCAGCATGG + Intergenic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102454179 12:113061268-113061290 CCCCAACCAGAGAGGGAGGAAGG + Intronic
1102789229 12:115630414-115630436 CTGAAAGCAGGGTGGGTGCAGGG + Intergenic
1103147828 12:118610829-118610851 CAGGAAGCAGAGAGGGGCCAGGG - Intergenic
1104373476 12:128244189-128244211 CAGCAAGGAGAGAGGGACCTCGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104610635 12:130225001-130225023 CTCCACGCAGAAAGGGAGAAGGG + Intergenic
1105257704 13:18755265-18755287 CTGCACACAGAGGGGGATCATGG + Intergenic
1105442883 13:20430014-20430036 GGGCTGGCAGAGAGGGAGCATGG - Intronic
1106138991 13:26994995-26995017 CTACATGCAGAAAGAGAGCAGGG - Intergenic
1106563417 13:30865558-30865580 CAGCACACAGAAAGGGAGCAGGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1109467053 13:62748930-62748952 CTGCAGGCAGAGAGTAATCAAGG - Intergenic
1109479433 13:62929487-62929509 CTGAAAGAGGAGAGAGAGCAAGG + Intergenic
1113060111 13:106313808-106313830 CAGCAAGAAGAGAGGGGTCAGGG + Intergenic
1113499374 13:110761095-110761117 TCACAAGCAGAGATGGAGCAAGG - Intergenic
1114617733 14:24077127-24077149 GGGCAAGCAGAGAGGGTGGAAGG - Intronic
1116639195 14:47439528-47439550 CCACAAGCATAGAGGGAGTAGGG - Intronic
1117153028 14:52908662-52908684 CTGCCAGCAGAGGGGCATCAGGG + Intronic
1117184692 14:53227794-53227816 ATCCAATCAGGGAGGGAGCATGG + Intergenic
1117461637 14:55951362-55951384 GTGCAAGCAGAGGGGAAGCATGG - Intergenic
1117791806 14:59349631-59349653 CTGCAAGCAGCAAGAGAGGAGGG - Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1119137582 14:72234679-72234701 CTGCAAGCAGAGACTGAGAGCGG - Intronic
1119658498 14:76434303-76434325 CTGGAAGCAGAGGGGGAGAGAGG - Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119782066 14:77282647-77282669 CTACAAGCAGAGAGTCAGAAAGG + Intronic
1120044562 14:79791251-79791273 CCACAAGCAGAGAGGATGCAAGG - Intronic
1120174017 14:81274499-81274521 CTACCAGAAGAGAGGGAGGATGG - Intronic
1120444931 14:84582642-84582664 AAGGAAGGAGAGAGGGAGCAAGG + Intergenic
1121574393 14:94971559-94971581 CTCCAAGCAGAGAGTGAGTCAGG + Intergenic
1121690262 14:95873222-95873244 AGGCAAGTAGAGAGGGAGCTAGG - Intergenic
1123123254 14:105927791-105927813 CCGCAAGCCTGGAGGGAGCATGG - Intronic
1123405904 15:20019295-20019317 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1123515234 15:21025943-21025965 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1124465309 15:29933795-29933817 CTGAAAGCAGAGGGAGAGGATGG + Intronic
1124627393 15:31316224-31316246 GTGCAAGCAAGGAGGGACCAGGG - Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1126896669 15:53264858-53264880 TTGCAAGAAGGGAGGGAGCAAGG - Intergenic
1127829955 15:62741998-62742020 CTACAAGCCAAGAGGGAGGAAGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1129170578 15:73805061-73805083 CTGCAAGGGGAGAGGGAGGCAGG + Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129423671 15:75450591-75450613 CAGCCAGGAGAGTGGGAGCATGG - Intronic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1130568427 15:85019053-85019075 ATGGAAGCAGGGAGGCAGCAAGG - Intronic
1132409701 15:101567559-101567581 GTGCAGGCAGAGAGAGATCAGGG + Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133393219 16:5425966-5425988 CTGGAAGGAGAGAGTGTGCAGGG + Intergenic
1133456962 16:5950852-5950874 GTGCCAGGAGAGAGGGAGCTAGG + Intergenic
1134090310 16:11388079-11388101 GGGCCAGTAGAGAGGGAGCAGGG + Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136409118 16:30066158-30066180 CTGCAAGAAAAGGGGGAGAATGG - Intronic
1137515145 16:49137049-49137071 CTGCAATCAGAGAGACAGCCCGG + Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138293389 16:55867121-55867143 TTCCCAGCAGAGAGGGAGCACGG - Intronic
1138392911 16:56683220-56683242 CTGCAAGAAGAGTGAGTGCAGGG + Exonic
1138770993 16:59663654-59663676 GTGAAAGCAGAGAGGCAGTAAGG - Intergenic
1139178776 16:64721282-64721304 CAGCAAGCATTCAGGGAGCACGG - Intergenic
1139449166 16:67016443-67016465 CTGTAAGCTGGGAGGGAGCATGG + Intergenic
1139609614 16:68046185-68046207 CAGGAAGCAGAGAGGAGGCAAGG - Intronic
1140380643 16:74484079-74484101 CATCAAGCAAAGAGGGGGCAGGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140505971 16:75473003-75473025 CTACCAGCAGGGAGGGAGCCTGG + Exonic
1141071867 16:80963991-80964013 CAGCAAACAGAGTGGGTGCAGGG - Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142675453 17:1510577-1510599 TTCCAAGGAGAGAGGGAGGAAGG - Intronic
1142975169 17:3639086-3639108 CTGAAATCAGAGTGGGAACAGGG + Intronic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1144298024 17:13897820-13897842 CTCCAGGCAGGCAGGGAGCACGG - Intergenic
1144381211 17:14700630-14700652 CTGCAAGGTGAGAGTGAGCAGGG - Intergenic
1145255950 17:21322478-21322500 CTGAAACCAGCGAGGGAGCCAGG - Intergenic
1145320672 17:21765467-21765489 CTGAAACCAGTGAGGGAGCCAGG + Intergenic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146778366 17:35643349-35643371 CAGTAAGCAGAGAGGAAGAAAGG - Intronic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1147218043 17:38912322-38912344 GAGGAAGGAGAGAGGGAGCAAGG + Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147899272 17:43773354-43773376 CTAAAAGCAGAAAGGGAGAAAGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148666037 17:49375687-49375709 ATGCCAGCAGAGAGGAAGCAGGG + Intronic
1148790317 17:50169049-50169071 CTGTCAGCAGAGTGGGGGCAGGG - Intronic
1148820291 17:50356062-50356084 CTGCAAGCAGCAAGGGAGAGTGG - Intronic
1151485332 17:74395440-74395462 CTGCTAGCAAAGCGGGAGAATGG - Intergenic
1151829390 17:76540704-76540726 CAGCAGGCGGACAGGGAGCAGGG - Intronic
1151905077 17:77042548-77042570 TGGAAAGCAGAGAAGGAGCATGG + Intergenic
1152499225 17:80697100-80697122 CTACAGTCAGAGAGTGAGCAAGG + Intronic
1153998375 18:10462430-10462452 AGGAAAGGAGAGAGGGAGCAAGG - Intronic
1154062133 18:11071902-11071924 CTGCTAGCAGAGCAGGAGCCAGG - Intronic
1154493105 18:14936365-14936387 AAGCAAGCAAAGAGGGAGGAAGG - Intergenic
1156022100 18:32611545-32611567 GAGCAAGGAGAGAGGGAGCGGGG - Intergenic
1156118329 18:33813943-33813965 TTGCAAGGAGAGAGAGATCAGGG - Intergenic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1156537356 18:37877121-37877143 CTGCAAGCAGCTAAGGAGCAAGG - Intergenic
1157298066 18:46460007-46460029 GTGCAAGCAGAGGGTGAGCAGGG + Exonic
1157724370 18:49952457-49952479 GTGAAAGGAGAGAAGGAGCACGG - Intronic
1158511073 18:58091123-58091145 ATGCAAGCTGAGAGAGAGCCAGG + Intronic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1158933665 18:62345234-62345256 CTGGAAGCAGAGAGCCAGAAAGG + Intronic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159782126 18:72672365-72672387 CTGGAAGCAGAGAAAGAGAAGGG + Intergenic
1160519616 18:79497084-79497106 TTGCAAGCCGAAGGGGAGCATGG + Intronic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1161906109 19:7157731-7157753 CACCAAGCAGAGTGGCAGCAGGG - Intronic
1161951789 19:7471604-7471626 CTGCCAGCACAGTGGGAGAAGGG - Exonic
1162550077 19:11353769-11353791 CTGCAAGAAGACAAGGAGCTGGG - Intronic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1163677251 19:18661267-18661289 CAGCAAGCAGAGAGGGTGCCCGG - Intronic
1164681738 19:30138848-30138870 CTCCAATCAGAGGGGCAGCATGG - Intergenic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165883493 19:39060334-39060356 CTGGAAGCAGAGAGGCAGTGTGG + Intergenic
1165953759 19:39489214-39489236 CTGCATCCAGAGAGGGGTCATGG + Intronic
1166053433 19:40274710-40274732 CTGCAGGCAGGGGAGGAGCAGGG + Intronic
1166146473 19:40840255-40840277 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166150519 19:40870868-40870890 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166965292 19:46526230-46526252 CTGCCGGCAGAGAGGGAGGGAGG + Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167603757 19:50469137-50469159 GTGAGGGCAGAGAGGGAGCAAGG - Intronic
1167619607 19:50553419-50553441 CTGGAAACAGCGAGTGAGCAGGG - Intronic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925039345 2:718521-718543 CTGCTGGCTGGGAGGGAGCAGGG - Intergenic
926130975 2:10302958-10302980 CGGCAGCCAGGGAGGGAGCAAGG - Intronic
926170246 2:10548683-10548705 CTGCAAGCACTGAGGGCGCCTGG - Intergenic
926547091 2:14255449-14255471 CTGTGAGCAGAGAGAGACCAGGG + Intergenic
927010279 2:18896990-18897012 ATGCAAACAGAGGGGCAGCATGG - Intergenic
927431418 2:23029451-23029473 CTGAAAGCTGACTGGGAGCAGGG - Intergenic
929239585 2:39640062-39640084 GTGCAGGCAGGGATGGAGCAGGG + Intergenic
929978718 2:46658949-46658971 GCCCCAGCAGAGAGGGAGCAGGG - Intergenic
930542909 2:52730025-52730047 CTTCAAGGAGAAAGGGAGCTAGG + Intergenic
930593093 2:53353529-53353551 CTGCAGGCTGTGTGGGAGCAGGG + Intergenic
930864094 2:56105880-56105902 CAGGAAGAAGAGAGAGAGCAGGG + Intergenic
932400637 2:71478887-71478909 AGGGAAGCAGAGAGGGATCAAGG - Intronic
932447688 2:71790868-71790890 CTGCAGGCAGAGAGGCTGCCAGG - Intergenic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
934655835 2:96116518-96116540 CTGCGAGCTGAGCGGGCGCAAGG - Intergenic
935107845 2:100062188-100062210 CTGCGAGCAATGTGGGAGCAAGG + Intronic
935325458 2:101931874-101931896 CTGGAAGCTTTGAGGGAGCATGG + Intergenic
935411476 2:102768872-102768894 CTACAAGCAGGGAGGCAGCGAGG + Intronic
935666301 2:105516016-105516038 CAGCAGGGAGATAGGGAGCAAGG - Intergenic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936484204 2:112912827-112912849 CTGCAACCAGAAAGGCACCAAGG - Intergenic
936869297 2:117114658-117114680 CTGCAAGCTGAGAAGGTGAATGG - Intergenic
936950929 2:117976806-117976828 CAGGAAGCAGAGGGGGAGCCTGG + Intronic
937287615 2:120763073-120763095 TGGGAAACAGAGAGGGAGCAGGG - Intronic
937434752 2:121871162-121871184 CTGCATCCAGATTGGGAGCAGGG - Intergenic
937860352 2:126703360-126703382 CTCCAGGCAGGGAGGAAGCAGGG + Intergenic
938095195 2:128456974-128456996 GTGGAAGCAGAGAGGAAGAATGG - Intergenic
938099624 2:128489823-128489845 CTGCCAGGAGAAAGGGAGGAAGG - Intergenic
938284947 2:130104655-130104677 CTGCCAGAAAAGAGCGAGCAAGG - Intronic
938335591 2:130493202-130493224 CTGCCAGAAAAGAGCGAGCAAGG - Intronic
938354233 2:130627461-130627483 CTGCCAGAAAAGAGCGAGCAAGG + Intronic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938430657 2:131234235-131234257 CTGCCAGAAAAGAGCGAGCAAGG + Intronic
938881538 2:135594586-135594608 TTGCTAGAAGAGAGGGAGCCGGG - Intronic
939153212 2:138496484-138496506 CTGAGAGCAGAGAAGGGGCAGGG + Intergenic
939698116 2:145353984-145354006 CTGGAAGCAGAGAGGTATCAGGG - Intergenic
940603763 2:155894029-155894051 CTGGAAGCAGGGAGAGAGAATGG - Intergenic
942455528 2:176135923-176135945 TTGCAAGATGAGAGGGAGGAGGG + Intergenic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944919250 2:204394252-204394274 CCACAAGGAGGGAGGGAGCAAGG - Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
945982182 2:216321553-216321575 TGGCAAGCTGAGAGGGAGAAAGG - Intronic
946062833 2:216959535-216959557 CTGCAAGGGGAGTGGGAGCAGGG + Intergenic
946252318 2:218421235-218421257 GTGCCAGCAGAGAGGGGCCAGGG + Intronic
946373466 2:219294620-219294642 CTGGAAGGAGAAAGGAAGCAGGG + Intronic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
946859840 2:223990169-223990191 CAGCAAGAAGAGAGAGGGCAAGG + Intronic
946916397 2:224527207-224527229 CTGAAAGCAGAGAAGGTGCCAGG + Intronic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
947205743 2:227659489-227659511 CTGCACGCAGTGAGGAGGCAAGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
948062501 2:235052060-235052082 CTGGAAGCAGTGGGGGAGAAGGG + Intronic
1168827390 20:823028-823050 CTCCAGGCAGAGATGGACCAGGG + Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1171013732 20:21522338-21522360 CTGCCAGCAGAGAGGGGTCTCGG - Intergenic
1171288234 20:23961177-23961199 CTTCAAGCAGAGGAGGGGCATGG + Intergenic
1171463387 20:25311407-25311429 CTGGAATCAGGGTGGGAGCAGGG - Intronic
1172842864 20:37912550-37912572 GTGCAGGCTGAGAGGGAGCCTGG + Intronic
1172872883 20:38146895-38146917 CTGCAACCAGTGGGGCAGCACGG + Intronic
1173246298 20:41340120-41340142 CTGCAGACAGGGAGGGAGCGCGG + Intergenic
1174110756 20:48196253-48196275 CTGCAAGCAGACAGGCAGGCTGG + Intergenic
1174255192 20:49249229-49249251 CTGGCAGCAGAGCCGGAGCATGG + Exonic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1175440796 20:58989827-58989849 TTGCAGGGAGAGAGGGGGCAGGG - Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1175717076 20:61262313-61262335 CTCTAAGCTGAGAGAGAGCAAGG + Intronic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1179065902 21:38024698-38024720 CTGCAAGGAGACAGAAAGCAAGG + Intronic
1179994293 21:44966914-44966936 CGGGAAGGAGAGAGGCAGCAGGG + Intronic
1180692256 22:17727189-17727211 CTACAAACAGAGATGTAGCAGGG - Exonic
1180929180 22:19577312-19577334 AAGCAAGCAGAGAGAGAGGAGGG - Intergenic
1181507961 22:23374401-23374423 TTCCCAGCAGAGAGGGAGCACGG - Intergenic
1181590453 22:23881520-23881542 CAGCAAGCAGTGTGGGTGCAGGG + Intronic
1181837473 22:25622684-25622706 CTGGGATCAGAGTGGGAGCATGG + Intronic
1182040809 22:27237619-27237641 ATGCAAGAAGACAGGGACCAGGG - Intergenic
1182109877 22:27715530-27715552 CTGCAGGCAGACAGGAAGCAGGG + Intergenic
1184062062 22:42089234-42089256 CTGCAACCAGAGAGGGTTCTGGG + Intronic
1184263373 22:43332579-43332601 CTCCCAGCTGAGAGGGAGCAGGG - Intronic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949508749 3:4750489-4750511 CTGCCTGCAGATAGTGAGCAAGG - Intronic
949684192 3:6549413-6549435 CATCAAGAAGAGAGGAAGCATGG + Intergenic
950083227 3:10238657-10238679 CTCCCAGCAGAGAGGGGGCGGGG - Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950211494 3:11126826-11126848 CTCCAGGCAGAGGGGCAGCATGG + Intergenic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
952573126 3:34741838-34741860 CTCCAAGGAGTGAAGGAGCAGGG - Intergenic
952733474 3:36664671-36664693 CTGCAGGCTGACAGGAAGCATGG - Intergenic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954872962 3:53781497-53781519 GTGCAAGCAGAGGAGGAGCTGGG + Intronic
954993738 3:54863402-54863424 CTGAAAGCAGGGAGGGAGAGTGG - Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
956487039 3:69733850-69733872 CTGCAAGCTCAGAGGCACCAAGG - Intergenic
956827275 3:73009661-73009683 CTACAAGCAGAGAGAAAGCAAGG - Intronic
958103495 3:89044631-89044653 CTGCCAGCTAAGAGGGAACATGG - Intergenic
958886339 3:99731964-99731986 CTACAAGCTGAGAGACAGCAAGG + Intronic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
961091799 3:124119143-124119165 CTGCAAGGCGAGAGGCAACAGGG + Intronic
961261632 3:125606592-125606614 TTTAAAGCAGAGAGGGAGAAAGG - Intergenic
961353407 3:126318113-126318135 GTGCAAGAAGAGAGTGGGCAGGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
963923333 3:150926032-150926054 CTGCGAGAAGAGAGGGAGACCGG + Intronic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964147447 3:153482640-153482662 CTGCAAGAAAAGAGGAATCAGGG + Intergenic
964417357 3:156461325-156461347 CTGGAAGCTAAGAGGAAGCAAGG - Intronic
966259005 3:177953003-177953025 TTGCAGGCAAAGAGAGAGCAAGG + Intergenic
966421226 3:179736401-179736423 CTGAAAGCAGAGAGTAGGCATGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
967672426 3:192253411-192253433 CAACAAGGAGAGAGGGAGGAAGG + Intronic
968726908 4:2252042-2252064 CTGGAAGGAGAGAGGGGGCCAGG - Intronic
969523402 4:7691974-7691996 GGGCAAGCAGGGAGGGAGGAAGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969636222 4:8370711-8370733 CTGCAACCACAGAGCCAGCATGG + Intronic
970705685 4:18799077-18799099 CTGCATGCAGAAAGGAAACAAGG - Intergenic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
972290766 4:37687651-37687673 CAGCAAGAAGAGGGGGTGCATGG + Intergenic
972948797 4:44292469-44292491 CTAGAAGTAGAGAGGGAGGAAGG + Intronic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
974193430 4:58538274-58538296 CTGCAAGCTGAGGAGGAGCAAGG + Intergenic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
976321787 4:83725177-83725199 AGGGAAGCAGAGAGGGAGAAAGG - Intergenic
976374051 4:84324347-84324369 CTGCAAACAGAGAGAGAGAGAGG - Intergenic
976472670 4:85447814-85447836 CTGCCAGGAGAAAGGGAGGAAGG + Intergenic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
978165011 4:105596482-105596504 CTGAAAGGAGACAGGGAGGAGGG + Intronic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
978630657 4:110739980-110740002 CTACAAGTAGAGAGGGAGGCAGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979703187 4:123690420-123690442 CAGAAGGCAGAGGGGGAGCAAGG + Intergenic
980730572 4:136818978-136819000 CAGGAAGCAAAGAGGCAGCATGG - Intergenic
981678108 4:147362907-147362929 CAGCAAGCAAAGAGGGAGATGGG + Intergenic
981725606 4:147843936-147843958 ATGCAAGTAGAGAGGTAGGACGG - Intronic
983316519 4:166139456-166139478 CTGGAAGCAGAGTGGGGACATGG - Intergenic
983795653 4:171859440-171859462 CTTCAGGAAGGGAGGGAGCATGG + Intronic
984067750 4:175070100-175070122 ATGCAAGCAGAGATGGGGCAAGG + Intergenic
984327405 4:178271543-178271565 CTGAAAGGGGAGAGGGTGCAGGG - Intergenic
985629994 5:1009189-1009211 CCGCAAGCGGAGAGAGAGCCCGG + Exonic
986062958 5:4209166-4209188 CTCCCAGCTGAGAGGGAGGAGGG + Intergenic
987323872 5:16794834-16794856 CTGCAAGCACAGAGTGAGACAGG + Intronic
987347861 5:16994567-16994589 CTGACAGCTGAGAGGGAGAAAGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
987862508 5:23506317-23506339 CTGCAAGGAGATACGGAGCCTGG - Intergenic
988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG + Intergenic
988781003 5:34521836-34521858 CTCAAAGCTGGGAGGGAGCATGG + Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990496713 5:56355318-56355340 CTTGAAGCAGAGAGGAAGAAGGG - Intergenic
992082960 5:73252476-73252498 CTGCAAGCAGAGGGAGTTCATGG - Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
995094329 5:108217201-108217223 CTGCCAGCAGAGAGGGGGTCTGG - Intronic
995833558 5:116378650-116378672 CAGCAAGCAGGGAGTGATCAAGG + Intronic
997264790 5:132489241-132489263 CTGCATGCAGGGAGTGTGCACGG - Intronic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
998775705 5:145599106-145599128 TTGCTAGCAGAGAGGCAACATGG + Intronic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
999204977 5:149841328-149841350 CTGCAAGGAGAGTGGGAGGAGGG + Intronic
999763300 5:154719324-154719346 CTTCCAGAAGAGAGGGAGCTGGG - Intronic
999772733 5:154787696-154787718 CTGGGAGCAGAGAAAGAGCAGGG + Intronic
1000992171 5:167922555-167922577 GTGCAAGCACAGAGAGAGGAAGG - Intronic
1001100286 5:168808728-168808750 CTGCAAAGAGAGGTGGAGCAGGG - Intronic
1001263775 5:170256984-170257006 CTGCAAGGAGAGAGTAAGCCAGG + Intronic
1001328442 5:170745824-170745846 CTGCACGCAGAGCGGGAGGGAGG + Intergenic
1002103182 5:176867402-176867424 CAGCCAGCAGAGGGGGAGCTGGG - Intronic
1002578839 5:180195005-180195027 CTGCAGGCAGAGGGGAAGCATGG - Intronic
1003308246 6:4947488-4947510 GTGCAAGCAGAGGGGCAGCCGGG - Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004011511 6:11692863-11692885 CTGCAAGGAGAGGCAGAGCAAGG + Intergenic
1004246511 6:13982642-13982664 GTGCAACCAGAGGGGGAGAATGG + Intergenic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004792931 6:19048904-19048926 CAGCAGGCAGAAAGGCAGCAAGG - Intergenic
1005952243 6:30640539-30640561 TTGCCCTCAGAGAGGGAGCAGGG - Exonic
1005959520 6:30685675-30685697 CTGCTAGCAGAGAGAAAGCCTGG - Exonic
1006630719 6:35427868-35427890 CTGCCAGCAGAGAGTGATCCTGG - Exonic
1007135040 6:39512592-39512614 GTGCCAGCATAGAGGGAGTAAGG - Intronic
1007414983 6:41686292-41686314 CTGCAACCAGAGCAGTAGCAAGG - Intronic
1007440997 6:41860250-41860272 TTGCAAGGAGAGAGGGAGGGAGG + Intronic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1010709913 6:79161906-79161928 CTGCACGCAGAGAAGCACCATGG - Intergenic
1011493213 6:87913697-87913719 CTGCCATCAGAAAGGGAGAAAGG - Intergenic
1011554557 6:88561165-88561187 ATGAGAGGAGAGAGGGAGCAAGG - Intergenic
1012248955 6:96958951-96958973 GTCCAAGCAGAGAGGGATGAGGG - Intronic
1012528183 6:100202592-100202614 CTTAAAGCAGAGAGGGGTCAGGG - Intergenic
1013315594 6:108939474-108939496 CAGGAAGAAGAGAGAGAGCAGGG - Intronic
1013356582 6:109350689-109350711 CTGGGAGCAGAAAGGAAGCAAGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014482063 6:121951126-121951148 CTGCAGGCTGTGTGGGAGCAGGG - Intergenic
1015360160 6:132330702-132330724 CTGAAAGTAGAGAGCAAGCAAGG - Intronic
1015714740 6:136180891-136180913 CTGCATGCAGGGAGGTTGCATGG - Intronic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016828277 6:148407983-148408005 CTACCAGCAGGGAGGGAACAGGG + Intronic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017960799 6:159218851-159218873 CAGGGAGCTGAGAGGGAGCAAGG + Intronic
1018902429 6:168058286-168058308 CTGCATGGAGAGAGAGAACAGGG - Intronic
1018902435 6:168058323-168058345 CTGCATGGAGAGAGAGAACAGGG - Intronic
1018944922 6:168341063-168341085 CTACAAGCAAAGGGGCAGCATGG - Intergenic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1020762848 7:12289765-12289787 CAGACAGCAGAGAGTGAGCAAGG - Intergenic
1021739029 7:23666930-23666952 ATGCAGTCAGAGAGGAAGCAGGG - Intergenic
1022483555 7:30759991-30760013 CTGGAAGGAGAGAGTGGGCAAGG + Intronic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023721830 7:43103573-43103595 GTGACAGCAGAGAGAGAGCAAGG + Intergenic
1023793347 7:43771038-43771060 CAGGAAGCAGTGGGGGAGCATGG + Intronic
1024553624 7:50584374-50584396 CTGCAAGGAGAGAGGATGGAGGG + Intergenic
1025209581 7:57013132-57013154 CTGCAAGCAGAGTTTGTGCATGG - Intergenic
1025662370 7:63563718-63563740 CTGCAAGCAGAGTTTGTGCATGG + Intergenic
1027250898 7:76398033-76398055 CTGCCAGGAGACAGGGAGCAGGG - Intronic
1028197725 7:87926750-87926772 CTGCAGGCTGTGTGGGAGCAGGG + Intergenic
1028713573 7:93938653-93938675 CTGCAACCAAAGAGAGAGGAAGG - Intergenic
1029316104 7:99715951-99715973 CTGCACGCATAGAGGAAGGATGG - Intronic
1029483120 7:100824720-100824742 CTGAAAGCAGAGAGGGGTCTTGG - Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030627063 7:111855782-111855804 CTGTAAACAGACAGAGAGCAGGG + Intronic
1031134733 7:117873051-117873073 CTGGACGCAGACAGGGAGCTGGG + Intronic
1032160129 7:129503222-129503244 CAGGAAGCAGAGAGTGAGCCTGG + Intronic
1032432524 7:131873435-131873457 AGGCAAGCAGAGAGGAAGGAAGG - Intergenic
1032935678 7:136729091-136729113 CTGCACGCTGTGTGGGAGCAGGG + Intergenic
1033170693 7:139081078-139081100 CTGGAAGCAGGGAGGAAGGAAGG + Intronic
1033471823 7:141656936-141656958 CTGGAAACAGAGAGAGAGCACGG + Exonic
1033585353 7:142770758-142770780 CTGAGAGCAGAGAGGGAGACCGG - Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034499534 7:151440609-151440631 CTTCAAGGAGAGAGGGACCCAGG - Intronic
1034609189 7:152349626-152349648 TAGCAAGGAGGGAGGGAGCAAGG + Intronic
1034985866 7:155515165-155515187 CTGCAAGCAGAGGGGCTTCAAGG + Intronic
1035178964 7:157075655-157075677 CTCCAAGCAGAGAGAGGGAAAGG - Intergenic
1035211542 7:157332326-157332348 CAGCAAGCACAGAGGCTGCAGGG - Intergenic
1036609043 8:10334072-10334094 CTGCAAGCAGGGAGGAAAAAAGG + Intronic
1036992999 8:13620429-13620451 CTAAAAGCAGAAAGTGAGCAAGG + Intergenic
1037273106 8:17151704-17151726 CAGCCAGCAGAGAGTGACCAAGG - Intergenic
1037815592 8:22110046-22110068 CTGGAAGGAGGGAGGGGGCAGGG + Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038367630 8:26952824-26952846 CTCCAAGCAGAGAAGGATCAGGG - Intergenic
1038455091 8:27667734-27667756 GAGCAGGCAGAGAGTGAGCAGGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039130765 8:34261733-34261755 CAGCAAACAGACAGGGGGCAGGG - Intergenic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1039944308 8:42116710-42116732 CTGGAAGCAGACAGGAAGCCAGG - Intergenic
1040102214 8:43515883-43515905 CTACAACAAGAGTGGGAGCAAGG - Intergenic
1040303767 8:46201615-46201637 AGGCAAGCAGAGAGGGGACACGG + Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1040975911 8:53194484-53194506 CTGGCAACGGAGAGGGAGCAGGG + Intergenic
1041548258 8:59071185-59071207 TTGCAAGGAGGGAGGGAGTAAGG + Intronic
1043283582 8:78501356-78501378 CAGGAGGCAGAGAGAGAGCAAGG + Intergenic
1043533112 8:81171972-81171994 CTGGGAGCAGAGAGAGACCAGGG + Intergenic
1043826279 8:84932673-84932695 CTACAGGTAGAGAGGAAGCAAGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045545626 8:103125694-103125716 CTGGAAGCAGTGAGCAAGCAGGG - Intergenic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1047419297 8:124693166-124693188 GTGCCAGCAGATAGGGATCAAGG + Intronic
1048332475 8:133480079-133480101 GAGAAAGAAGAGAGGGAGCAGGG + Intronic
1048644639 8:136406314-136406336 CTGGAAGCAGGGAGGCAGAAAGG + Intergenic
1049388507 8:142356247-142356269 CCCCACGCAGAGAGGCAGCAGGG + Intronic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049682275 8:143924755-143924777 CTGCGGGCCGAGACGGAGCAGGG - Exonic
1051129314 9:13841756-13841778 CTGCTTGCAGAGAGGAATCAGGG - Intergenic
1051140055 9:13969161-13969183 CTGCGAACAGAGAAGAAGCATGG + Intergenic
1051708971 9:19910575-19910597 CTGCAAGTAGAGAGAGTACAGGG - Intergenic
1052231600 9:26161033-26161055 ATGAAGGCAGAGAGGTAGCAGGG + Intergenic
1052345696 9:27407567-27407589 CTCCAAGAAGAGAGGAAGGAAGG - Intronic
1052901055 9:33795342-33795364 CTGAGAGCAGAGAGGGAGACTGG - Intronic
1053465926 9:38308544-38308566 ATGGAAGCAGAGAGGGGCCAAGG - Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1055432767 9:76260698-76260720 CTAAAAGCAGAGTGGCAGCAGGG - Intronic
1056062184 9:82895018-82895040 CTAAAAGCAGAGAGGCTGCAAGG - Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057230327 9:93317782-93317804 CTGCAAGAAGACTGGCAGCACGG - Intronic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1058766820 9:108189916-108189938 CTGGCAGCAGGGAGGGGGCAGGG + Intergenic
1059592494 9:115677256-115677278 CTAAAAGCAAAGAGGGATCATGG - Intergenic
1060342923 9:122792792-122792814 CTCCAAGAAGAGGTGGAGCATGG + Intergenic
1060516389 9:124268580-124268602 CAGCAAGCAGAGAGAGAGCCAGG - Intronic
1060532287 9:124354972-124354994 CTGCGGGCAGACAGGCAGCAGGG + Intronic
1060787319 9:126460772-126460794 CTGCCAGCAGAGGTGGAGCCAGG - Intronic
1060815416 9:126632649-126632671 CGGGAACCAGAGAGGGAACAGGG + Intronic
1061024939 9:128042422-128042444 CTGGAACCAGAGAGGTAGGAAGG + Intergenic
1061140635 9:128764102-128764124 CTGCAAGGAGAGGGGGTGCATGG + Intronic
1061205022 9:129157959-129157981 CTGCCCGCAGCCAGGGAGCACGG + Intergenic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061751530 9:132780927-132780949 CTGCAAGGAGGGAGGGGGCAGGG - Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1061821911 9:133233725-133233747 AGGCAAGCACAGAGGGTGCAGGG + Intergenic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062745749 9:138210962-138210984 CTGCGGCCAGACAGGGAGCAGGG - Intergenic
1186536198 X:10351223-10351245 CCCCAAGCAGAGAGGGAGTATGG - Intergenic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187601793 X:20839421-20839443 CTGCTAGCAGGGAGAGAGCAGGG - Intergenic
1187929069 X:24277383-24277405 ATGCGGGGAGAGAGGGAGCATGG - Intergenic
1188005842 X:25015346-25015368 CTGGAAGCAGGGAGGGAGGGAGG + Intronic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189380887 X:40501348-40501370 CTGCAAGGAGGGAGGGAGGGAGG - Intergenic
1193121101 X:77823715-77823737 CTGCAAGCTGAGGAGGAGCAAGG - Intergenic
1194106151 X:89769439-89769461 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1194756356 X:97743646-97743668 ATGAAAGCAGCCAGGGAGCAGGG + Intergenic
1195686208 X:107588685-107588707 CTGCAAGGAGACAGGGAGAATGG - Intronic
1195859265 X:109363798-109363820 CGGCATGCAGAGAGGGAACAAGG - Intergenic
1195893251 X:109718979-109719001 CTTCAATCAGAGGGGGTGCAGGG + Intronic
1196027961 X:111062630-111062652 TTGCAAGAAGAGAGGAAGAAAGG + Intronic
1199818218 X:151419024-151419046 CTGCAAGGAGAGAGAGGACAGGG + Intergenic
1199895647 X:152125113-152125135 GTGCATGGAGAGAGGGAGAAAGG - Intergenic
1200114805 X:153765355-153765377 CTGCCAGCTGTGAGGGAGCCCGG + Intronic
1200322621 X:155205720-155205742 ATGGAAGCAGAGAGGAAGCATGG - Intronic
1200329568 X:155282184-155282206 CTGAAAGAAAAGTGGGAGCAAGG - Intronic
1200458107 Y:3417298-3417320 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1201359315 Y:13129035-13129057 CTGCAAGAAGAGATGGGGCTTGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic