ID: 1148319174

View in Genome Browser
Species Human (GRCh38)
Location 17:46735592-46735614
Sequence TAGCTGACCCTCAACAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148319174_1148319175 10 Left 1148319174 17:46735592-46735614 CCTACTCTGTTGAGGGTCAGCTA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1148319175 17:46735625-46735647 TAGTGAAGCCCTTTGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 138
1148319174_1148319176 13 Left 1148319174 17:46735592-46735614 CCTACTCTGTTGAGGGTCAGCTA 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1148319176 17:46735628-46735650 TGAAGCCCTTTGTAAACTGGTGG 0: 1
1: 0
2: 4
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148319174 Original CRISPR TAGCTGACCCTCAACAGAGT AGG (reversed) Intronic
900885516 1:5412639-5412661 TAGCTGGCTCTGAACAGAGATGG + Intergenic
901517383 1:9757813-9757835 TCGCTGCCCCTCAACACACTGGG + Intronic
902698450 1:18155774-18155796 TGTCTGGCCTTCAACAGAGTGGG - Intronic
903726371 1:25449414-25449436 TAGCTGCCCAAAAACAGAGTAGG - Intronic
908036072 1:60054997-60055019 TTGCTGACCACCAACGGAGTTGG - Intronic
912365287 1:109128468-109128490 TAGGTGACACTCCCCAGAGTGGG - Intronic
914938300 1:151999972-151999994 CAACTGCCCCTCCACAGAGTGGG - Intergenic
917736435 1:177925204-177925226 TAGCTGGTCCTCAGCAGAGATGG - Intronic
918815535 1:189175870-189175892 TAGCTGAATCTCAACACAGAAGG - Intergenic
1067478643 10:46581778-46581800 TAGCTGAGGCTCAGCAGAGACGG + Intronic
1067616094 10:47760023-47760045 TAGCTGAGGCTCAGCAGAGACGG - Intergenic
1067697137 10:48543424-48543446 TAGCTGGTCCTGAGCAGAGTGGG - Intronic
1069168147 10:65189972-65189994 TATCAGACCCTGAATAGAGTGGG - Intergenic
1071195568 10:83154962-83154984 TAGCTGACCTTCAACAGCTAAGG - Intergenic
1071309951 10:84333755-84333777 TAACTGATACACAACAGAGTGGG + Intronic
1072403451 10:95128128-95128150 GAGCTGTCCCTCAACTGAATTGG + Intergenic
1076933053 10:133546558-133546580 TGGCTGCCCCTTGACAGAGTGGG - Intronic
1077332771 11:1990614-1990636 CGGCTGACCTCCAACAGAGTGGG - Intergenic
1078778297 11:14413549-14413571 TAGCTGAGCCCAAACAGAATGGG - Intergenic
1079103671 11:17557315-17557337 TGTCTGACCCTCACCAGAGCTGG - Exonic
1081033481 11:38114221-38114243 CAACTGACCCTCAAGTGAGTCGG - Intergenic
1081521210 11:43882870-43882892 TAGCTCACCATCAACAAAATCGG - Intronic
1081667137 11:44923261-44923283 TGGCTGCCCCTCATCAGATTAGG + Intronic
1082119634 11:48364689-48364711 TAGCTGACCCAAAAGAGAATTGG - Intergenic
1082254660 11:50020489-50020511 TAGCTGACCCAAAAGAGAATTGG + Intergenic
1085220785 11:74872280-74872302 TAGCTGTCCCTTGACTGAGTAGG - Intronic
1088506596 11:110533274-110533296 TAGCAGTCCCTCAGTAGAGTTGG - Intergenic
1090915527 11:131159323-131159345 TGGCTGACCCTCATCAGTTTGGG + Intergenic
1202815754 11_KI270721v1_random:45790-45812 CGGCTGACCTCCAACAGAGTGGG - Intergenic
1091605528 12:1948483-1948505 TAGCTAACACTCCACAGAGCTGG - Intronic
1094203692 12:27818302-27818324 TACCTGACCCTGAACATAATTGG - Intergenic
1099353225 12:81600090-81600112 TAGTACACCCTCAACAGGGTTGG + Intronic
1101091019 12:101285580-101285602 CAGCAGACCCTCAAAAAAGTAGG - Exonic
1102563581 12:113779802-113779824 AAGCTGACCCTCAAACAAGTGGG + Intergenic
1116631294 14:47337876-47337898 TAGCTTACACTAAACAAAGTGGG - Intronic
1119812120 14:77530935-77530957 TAGATGAGTCTCAACAGGGTGGG - Intronic
1121270412 14:92634014-92634036 AAGCTGACCCTCCAGAGTGTGGG + Intronic
1123885033 15:24718339-24718361 TGGCTGCCCCTCAGCAGAGCTGG + Intergenic
1126054451 15:44716558-44716580 TTACTGACCCTCTACAGAGAGGG + Intronic
1126977700 15:54202872-54202894 TAACAGACCATCAACAGAATGGG + Intronic
1131116310 15:89798218-89798240 TACCTCACCCCAAACAGAGTAGG + Intronic
1131183063 15:90253626-90253648 TAGCTGGCCCTCTCCAGGGTGGG + Intronic
1134309710 16:13064828-13064850 AAGATTACCCTCACCAGAGTGGG + Intronic
1139939905 16:70597781-70597803 TAGCTGTCCCTCTCCAGAATAGG + Intronic
1143350860 17:6287194-6287216 TCTCTGACCCTCAACAAAGGAGG - Intergenic
1147558490 17:41494910-41494932 TGGCTGCCCCTCCACAGTGTTGG + Intergenic
1148319174 17:46735592-46735614 TAGCTGACCCTCAACAGAGTAGG - Intronic
1159250726 18:65872506-65872528 AAGATGACCCTGAAAAGAGTGGG + Intronic
1162530664 19:11234524-11234546 TAGTGAACCCTCAATAGAGTTGG - Intronic
1168139696 19:54377018-54377040 TATTTTACCCTCAAGAGAGTGGG + Intergenic
1168589644 19:57622262-57622284 CAGCTTTCCCTCAACAGTGTTGG - Exonic
932394512 2:71432066-71432088 TAGCTGACCATGAACAAAGTCGG - Intronic
932418761 2:71589092-71589114 TTGCTCACCCTCAGCAGAGTGGG + Intronic
933657703 2:84903304-84903326 AAGCCCACCATCAACAGAGTGGG - Intronic
934605236 2:95690059-95690081 TAGCTGAACATCTACAGAATGGG + Intergenic
941338212 2:164270787-164270809 TATCTAATCCTCAACAAAGTTGG - Intergenic
944115585 2:196182964-196182986 TATCTGAGCCTCAACAGTCTGGG + Intergenic
944789789 2:203113232-203113254 TAGCTGACCCTCCAGAGATGTGG - Exonic
1168804022 20:662398-662420 TTGCTGACCCTCAACTGGGGGGG - Exonic
1173682672 20:44897055-44897077 TAGCTGACCCCAAACAGAAAGGG + Intronic
1174158371 20:48532255-48532277 CTGCTGTCCCTCAACAGAGAAGG + Intergenic
1175832650 20:61974670-61974692 TAGCTGAGCCCCATCAGAGCCGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183446826 22:37862359-37862381 TATCTGACCCTCCACAGAGAAGG - Intronic
1184877171 22:47283206-47283228 TTGCTGCCCTTCACCAGAGTGGG - Intergenic
949761325 3:7474024-7474046 AAGCTGACCCTTCACAGAGCTGG - Intronic
953866170 3:46585150-46585172 TGGGTGAACTTCAACAGAGTAGG + Intronic
959338077 3:105092066-105092088 TATCTGATCTTCAACAGACTTGG - Intergenic
961261703 3:125607085-125607107 CAATTGACCCTCAACGGAGTTGG - Intergenic
964128167 3:153258442-153258464 AAGCTGACCCTGAAGAGAGATGG - Intergenic
966609067 3:181850195-181850217 TAGCTGAACAACAAAAGAGTTGG - Intergenic
970389695 4:15595196-15595218 GAACTGAGCCTCAACATAGTAGG + Intronic
970429196 4:15973061-15973083 CAGCTGACCCTCACCTGTGTAGG - Intronic
973738010 4:53891416-53891438 TAGAGGACCCTGAAGAGAGTTGG + Intronic
982587940 4:157266365-157266387 CAGCTGATGGTCAACAGAGTAGG + Intronic
984557030 4:181226638-181226660 GAGCTGACCCTGACCAGAGCAGG - Intergenic
985390838 4:189490701-189490723 TGGCTGACCCTCACCGGTGTGGG + Intergenic
985391189 4:189492021-189492043 TGGCTGACCCTCACCCGGGTAGG + Intergenic
986939423 5:12932535-12932557 TAGCTGACACACAAGAGATTGGG - Intergenic
993919127 5:93778666-93778688 TAGCTGACTTTCATCAGATTTGG - Intronic
1004074935 6:12336483-12336505 AAGATGACCCTCAATACAGTGGG + Intergenic
1006550834 6:34821861-34821883 TAGCTGACCCTCCAGAAAGCAGG - Intronic
1009798314 6:68501321-68501343 TAGCTGAGCCTCAGGAAAGTTGG + Intergenic
1016343263 6:143084648-143084670 TAGTTGGCCTTCAATAGAGTCGG + Intronic
1016759255 6:147719082-147719104 AAGCTGACACTCAGCAGCGTGGG - Intronic
1016904330 6:149133882-149133904 TCACTGACTTTCAACAGAGTTGG - Intergenic
1020598995 7:10248465-10248487 TGGCTGTCCCTTAGCAGAGTGGG - Intergenic
1025871419 7:65437947-65437969 GAGCTGAACATGAACAGAGTAGG - Intergenic
1027238001 7:76309616-76309638 TAGCTGCCTCTCAGCAGAGCAGG - Intergenic
1032543575 7:132724250-132724272 TAGCTGACCCCCATCAGGGGAGG - Intronic
1037028301 8:14067929-14067951 TAGCTGACCCTCCAAACTGTGGG - Intergenic
1041350764 8:56946009-56946031 CAGCTGACCCACATCAGAGGGGG + Intergenic
1049418741 8:142507480-142507502 GGCCTGACCCTCAGCAGAGTAGG + Intronic
1051828853 9:21253134-21253156 AAGCTGACTCTCCACAGAGTTGG + Intergenic
1055183670 9:73422918-73422940 TAGCTGATCATAAACAGGGTTGG - Intergenic
1055516589 9:77039990-77040012 TACCTGCCCCTCCACACAGTAGG + Intergenic
1058496341 9:105563037-105563059 TAGGTGATTCTCAAAAGAGTGGG + Intronic
1058828537 9:108795704-108795726 TAGTTGTCCCTCAACTGAATTGG - Intergenic
1061080279 9:128365664-128365686 TAGCTGGGCATCCACAGAGTGGG + Intergenic
1061332500 9:129904467-129904489 TTGCTGACACTCATCAAAGTTGG - Intronic
1062046805 9:134428229-134428251 CAGCAGCCCCTCAACACAGTGGG - Intronic
1062046821 9:134428281-134428303 CAGCAGCCCCTCAACATAGTGGG - Intronic
1062046864 9:134428430-134428452 CAGCAGCCCCTCAACATAGTGGG - Intronic
1062046899 9:134428531-134428553 CAGCAGCCCCTCAACATAGTGGG - Intronic
1062046915 9:134428581-134428603 CAGCAGCCCCTCAACATAGTGGG - Intronic
1194412317 X:93572296-93572318 GAGCTCACTCTCAACAGAGAAGG - Intergenic
1199081445 X:143580719-143580741 TAGCTGTCCCTCAAGATTGTTGG + Intergenic
1199106416 X:143874543-143874565 TAGCTTTCCCTCAACAGATGGGG + Intergenic
1200880797 Y:8209679-8209701 CAGTTGACCCTCAAGGGAGTTGG + Intergenic
1201473162 Y:14355203-14355225 CAGTTGACCCTCAAGGGAGTTGG + Intergenic