ID: 1148323835

View in Genome Browser
Species Human (GRCh38)
Location 17:46772067-46772089
Sequence TCCCCACACCACCGCCGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148323835_1148323853 29 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323853 17:46772119-46772141 CCGGAGCTGGGCGCGAACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 267
1148323835_1148323850 17 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323850 17:46772107-46772129 GCAAACGTGGGGCCGGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1148323835_1148323848 10 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323848 17:46772100-46772122 GCGGGGTGCAAACGTGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 125
1148323835_1148323851 28 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323851 17:46772118-46772140 GCCGGAGCTGGGCGCGAACCTGG 0: 1
1: 0
2: 0
3: 13
4: 847
1148323835_1148323843 -7 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323843 17:46772083-46772105 GTGGGGACTCGCCGGGGGCGGGG 0: 1
1: 0
2: 4
3: 22
4: 272
1148323835_1148323849 16 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323849 17:46772106-46772128 TGCAAACGTGGGGCCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1148323835_1148323845 4 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323845 17:46772094-46772116 CCGGGGGCGGGGTGCAAACGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1148323835_1148323841 -9 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323841 17:46772081-46772103 GTGTGGGGACTCGCCGGGGGCGG 0: 1
1: 0
2: 1
3: 18
4: 169
1148323835_1148323846 5 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323846 17:46772095-46772117 CGGGGGCGGGGTGCAAACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 68
1148323835_1148323842 -8 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323842 17:46772082-46772104 TGTGGGGACTCGCCGGGGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 200
1148323835_1148323847 6 Left 1148323835 17:46772067-46772089 CCCACGCGGCGGTGGTGTGGGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1148323847 17:46772096-46772118 GGGGGCGGGGTGCAAACGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148323835 Original CRISPR TCCCCACACCACCGCCGCGT GGG (reversed) Intronic
901116868 1:6852837-6852859 TCCCCACCCCACCACCTCCTGGG - Intronic
901211402 1:7528100-7528122 TCCCCACACCATCGCTGCCTTGG + Intronic
902304766 1:15527309-15527331 TTCCCAGACCACCGCCACTTCGG + Intronic
906198947 1:43947196-43947218 TACCCACAACACCCCCGCCTGGG - Exonic
908999931 1:70205866-70205888 TCCCCACACCCTCGCCACGGTGG - Intronic
910542052 1:88370751-88370773 TCCCCACACCCCCACCTCGAAGG + Intergenic
918182022 1:182092239-182092261 TCCCAACACCACCTCCACATTGG + Intergenic
919773383 1:201177256-201177278 TCCCCACAGCACCTCAGCCTGGG - Intergenic
920284585 1:204870537-204870559 TCCCCACCCCACCCCCGCCTTGG + Intronic
920385838 1:205569604-205569626 TCCCCCACCCACCGCCCCGTGGG + Intronic
923098473 1:230793915-230793937 TCCCCACACCACGTCAGGGTAGG - Intronic
924668079 1:246094312-246094334 TCCACACACCAACTCCGTGTGGG + Intronic
1063123879 10:3123707-3123729 GCCCCTCAGCACCGCCACGTGGG - Intronic
1070408871 10:76121088-76121110 TCCTCACACCACCCGCACGTAGG + Intronic
1072578536 10:96720765-96720787 TCCCCACACCCCCTCCACCTCGG - Intergenic
1076150164 10:128155466-128155488 TCACCACACCTCCGCCTCTTGGG + Intergenic
1084939023 11:72602458-72602480 TCCCCACACCCCCACCTCCTCGG + Intronic
1096769906 12:53928376-53928398 TTCCCACCCCACAGCTGCGTAGG - Intergenic
1103944744 12:124519801-124519823 GCCTCACACCACCGCGGCATAGG + Intronic
1107327723 13:39263137-39263159 TCACCACACCACTGCCACCTTGG + Intergenic
1110573354 13:77029236-77029258 TTCCCACACCACCCCAGCCTTGG + Intergenic
1112652646 13:101416123-101416145 TCCCCACCCCTCCCCCGCGCGGG + Intronic
1113465877 13:110512621-110512643 TCCCCACACGAGGGCCCCGTGGG + Exonic
1113767414 13:112889835-112889857 ACCCCACCCCACCGCCGCACAGG - Intergenic
1117377584 14:55129789-55129811 TCCCCAGATCACGGCCGCGGGGG + Intronic
1120835558 14:89035744-89035766 GCCCCACTCCATCGCCGGGTAGG + Intergenic
1121001868 14:90456830-90456852 TCCCCACTCCACATCCGTGTGGG - Intergenic
1121207933 14:92185139-92185161 TCCCCACACCCTCGCCTAGTGGG + Intergenic
1121743450 14:96269575-96269597 TCCTCACTCCACCACCGCATGGG + Intergenic
1128267546 15:66279935-66279957 TCCCCACATCCCCGTCGGGTTGG + Intergenic
1128302336 15:66574416-66574438 TCCCCACACCTCCGCCCTGCAGG - Intergenic
1129740245 15:77986472-77986494 TGTCCACAGCTCCGCCGCGTCGG - Intronic
1132229161 15:100168998-100169020 TGCCCCCACCACCACCGCGCTGG - Intronic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1135479825 16:22813710-22813732 TCTCCTCCCCACCCCCGCGTGGG + Intergenic
1141694862 16:85614425-85614447 TCCCCTCCCCAGCGCCGGGTGGG + Intronic
1142367519 16:89657853-89657875 TCCCCACACCTCCGCGGCCGCGG - Exonic
1148323835 17:46772067-46772089 TCCCCACACCACCGCCGCGTGGG - Intronic
1149621798 17:58050856-58050878 TCCCCACACCACCCCCGAAGAGG - Intergenic
1151239301 17:72745293-72745315 TCCCCACAGCACCTCTGAGTGGG - Intronic
1151565323 17:74894246-74894268 TCCCCACTCCCCCTCCCCGTGGG + Intergenic
1157248254 18:46072076-46072098 GCCCCCCACGCCCGCCGCGTTGG + Intronic
1157529602 18:48409725-48409747 CCCCCACTCCGCCTCCGCGTCGG - Intronic
1161092927 19:2371810-2371832 TCACCCCATCACCACCGCGTTGG + Intergenic
1162958538 19:14113083-14113105 TCCCCTCTCCACCCCCGCATAGG - Intronic
1165770167 19:38375314-38375336 TTCCCCCACCACCCCCGCGTGGG - Intronic
1166844448 19:45718130-45718152 TCCCCACTCCTCCGCCCCGCAGG + Intronic
1167109076 19:47448226-47448248 TCCCCACCCCGCCGCAGCGAGGG - Exonic
944413598 2:199463558-199463580 TCCCGACAGCGCCACCGCGTGGG + Intronic
944414311 2:199467758-199467780 CCCCCTCACCACCACCACGTTGG + Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175080885 20:56419451-56419473 CCCCCACACCACCCCCGCTCAGG + Intronic
1176414669 21:6467681-6467703 TCCCCACCCCGCCGCAGCCTGGG + Intergenic
1179590894 21:42407184-42407206 TCCCCACAGCACATCCGGGTAGG - Intronic
1179690169 21:43076003-43076025 TCCCCACCCCGCCGCAGCCTGGG + Intronic
1181158504 22:20941245-20941267 TCCACACACCACCACGGCATGGG - Intronic
1181583170 22:23838894-23838916 TGTCCTCACCACCGCCGCGGTGG - Exonic
1184409747 22:44319632-44319654 TCCCCACACCACAGCGGAGAGGG + Intergenic
1185212399 22:49577592-49577614 TCCCCACACCCCTGCCCTGTGGG + Intronic
1203252499 22_KI270733v1_random:124763-124785 TCCCCCCACCACCGCCGCCGCGG - Intergenic
950655442 3:14433465-14433487 ACCCCACACCTCGGCCGCCTGGG - Intronic
950829571 3:15860076-15860098 TCCCCACGCCACCTCCGCCCCGG - Intergenic
950912162 3:16605551-16605573 ACCCTACGCCCCCGCCGCGTGGG - Intronic
956662875 3:71616639-71616661 TTCACACACCACCGCCTCTTTGG + Intergenic
968799351 4:2732119-2732141 TCCTCCCACCACCGCGGCCTCGG + Exonic
969325908 4:6443764-6443786 TCCCCACCCCACCGCCCCCCCGG + Intronic
973330365 4:48906221-48906243 TCCCCGGACCACCCCAGCGTGGG - Intronic
977524338 4:98125956-98125978 TCCCCACACCACGGCACAGTGGG - Intronic
980930261 4:139177359-139177381 CCCCCGCCCCCCCGCCGCGTGGG - Intergenic
982630506 4:157824167-157824189 TCCGCTCACCACCTCCGCCTGGG + Intergenic
993005494 5:82424498-82424520 TCCCCACACGACCCCAGCTTTGG - Intergenic
994002382 5:94795246-94795268 TCCCCACCCCACCCCCGCCCAGG - Intronic
998407717 5:141883313-141883335 TCCCCACACCACCCCCCGCTGGG - Intergenic
1003315034 6:5004108-5004130 TCCCCACTCCACCGCCGCCAGGG - Intergenic
1006472225 6:34235646-34235668 TCCCCACCCCGCCTCCGCGCCGG + Intergenic
1006676914 6:35771244-35771266 TGCCCACACCACCTGTGCGTAGG - Intergenic
1006891563 6:37433438-37433460 TCTCCCCTCCACCGCCGCCTGGG + Intronic
1015811229 6:137163850-137163872 TCCCCACATCAACCCCGCCTTGG - Intronic
1016386855 6:143537359-143537381 TCCCCACACTGCCGCCTCCTCGG + Intronic
1019548871 7:1592406-1592428 TCCCCACACCCCCGCAGAGTGGG - Intergenic
1024028420 7:45433686-45433708 TCCCCCAACCACCGCCTGGTGGG + Intergenic
1027228601 7:76260043-76260065 GCCCCCCACCCCCGCCGCGGCGG - Intronic
1035761081 8:2069343-2069365 TCTCACCACCACCGCCGCGTTGG - Exonic
1037273906 8:17157111-17157133 TCCGCTCACCGCCGCCGCCTCGG + Intronic
1044751934 8:95424392-95424414 TCCCCACCCCACCACCCCCTTGG - Intergenic
1046379973 8:113437591-113437613 TCCCCACCCCACCCCCGCCCAGG - Intergenic
1048073075 8:131041136-131041158 TCCCCACACCCCCTCCGGGAGGG - Exonic
1049195461 8:141313268-141313290 CCCCCACCCCACCGCTGTGTAGG - Intergenic
1049708249 8:144052518-144052540 GCCGCCCACCACCGCCGCCTCGG + Exonic
1055611529 9:78030677-78030699 TCCCCACGCCACCACCCCATGGG + Intronic
1056844267 9:90023865-90023887 TCCCCACTCCACAGCTGCGAAGG + Intergenic
1062452352 9:136620990-136621012 TGCCCACCCCACCGCCACCTGGG + Intergenic
1185464992 X:349153-349175 TCCCAACACCATCGCCTCGGGGG - Intronic
1186545937 X:10449558-10449580 GCCCCCCACCTCCGGCGCGTGGG - Exonic
1187759007 X:22559059-22559081 TCCCCACACCTCCTCCCCATTGG - Intergenic
1190877033 X:54467428-54467450 TCACCACACCTCCGCCTCCTGGG + Intronic