ID: 1148323867

View in Genome Browser
Species Human (GRCh38)
Location 17:46772178-46772200
Sequence TATGCGCTCGCGGCGTCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148323861_1148323867 5 Left 1148323861 17:46772150-46772172 CCGGGCTCTGGGCACCGACCGGG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1148323867 17:46772178-46772200 TATGCGCTCGCGGCGTCTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 7
1148323857_1148323867 19 Left 1148323857 17:46772136-46772158 CCTGGGTTCAAGGTCCGGGCTCT 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1148323867 17:46772178-46772200 TATGCGCTCGCGGCGTCTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 7
1148323864_1148323867 -9 Left 1148323864 17:46772164-46772186 CCGACCGGGGCGCGTATGCGCTC 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1148323867 17:46772178-46772200 TATGCGCTCGCGGCGTCTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148323867 Original CRISPR TATGCGCTCGCGGCGTCTTC CGG Intronic
924594765 1:245435373-245435395 TTTGCTCTCCCGGTGTCTTCAGG + Intronic
1068693818 10:59944586-59944608 TCTGGGCCCGCGGTGTCTTCTGG - Intergenic
1093164438 12:15789191-15789213 TCTGGGCTCGCGGCGTCTCCGGG - Exonic
1148323867 17:46772178-46772200 TATGCGCTCGCGGCGTCTTCCGG + Intronic
1164478912 19:28596673-28596695 TATGCGCTCACAGCGGCTTGTGG - Intergenic
934978668 2:98823068-98823090 AACGGGCTCGCGACGTCTTCGGG + Exonic
961508705 3:127388282-127388304 TATGCCCTGCCAGCGTCTTCTGG - Intergenic
961685299 3:128625753-128625775 TTTGAGCTCATGGCGTCTTCTGG - Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic