ID: 1148332193

View in Genome Browser
Species Human (GRCh38)
Location 17:46819531-46819553
Sequence GGATTCTCGGTTGGACCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148332181_1148332193 21 Left 1148332181 17:46819487-46819509 CCGACCTCTGGCCCGGGTCGGAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332184_1148332193 10 Left 1148332184 17:46819498-46819520 CCCGGGTCGGAGGCGTGACCCAC 0: 1
1: 0
2: 1
3: 7
4: 206
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332180_1148332193 22 Left 1148332180 17:46819486-46819508 CCCGACCTCTGGCCCGGGTCGGA 0: 1
1: 0
2: 0
3: 10
4: 72
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332185_1148332193 9 Left 1148332185 17:46819499-46819521 CCGGGTCGGAGGCGTGACCCACA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332188_1148332193 -8 Left 1148332188 17:46819516-46819538 CCCACAGCCTCAGTGGGATTCTC 0: 1
1: 0
2: 1
3: 19
4: 218
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332183_1148332193 17 Left 1148332183 17:46819491-46819513 CCTCTGGCCCGGGTCGGAGGCGT 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1148332189_1148332193 -9 Left 1148332189 17:46819517-46819539 CCACAGCCTCAGTGGGATTCTCG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148332193 Original CRISPR GGATTCTCGGTTGGACCATC AGG Intronic
905616876 1:39407820-39407842 GGAATCTCTGTCGGACCATGTGG - Intronic
914869790 1:151463385-151463407 GGTCTCTCTTTTGGACCATCTGG + Intergenic
1063148326 10:3316296-3316318 AGATTGTCGTTTGGATCATCTGG - Intergenic
1065772861 10:29093822-29093844 GGATTCTAGGTAGGACCCTGGGG - Intergenic
1082727399 11:56752559-56752581 GGATTCTCCTTTAGAACATCTGG + Intergenic
1082963031 11:58937291-58937313 GGATGCTCCTTTGGACCTTCAGG + Intronic
1094678035 12:32640462-32640484 GGATGCTCATTTGGACCACCTGG - Exonic
1104372185 12:128233777-128233799 GGATTCTCCTTTGGAGCCTCTGG - Intergenic
1106341827 13:28837059-28837081 GGAGTCTGAGCTGGACCATCAGG - Intronic
1114243943 14:20895057-20895079 GGATTCTGTGCTTGACCATCAGG + Intergenic
1114247005 14:20923632-20923654 GGATTCTGTGCTTGACCATCAGG + Intergenic
1116968316 14:51038269-51038291 GGATTCTCCTTTAGAGCATCCGG + Intronic
1119175873 14:72567385-72567407 GCCTTCTCAGCTGGACCATCTGG + Intergenic
1125792194 15:42375403-42375425 GGCTTCTCGGTTGCGCCATAAGG - Intronic
1140976001 16:80061055-80061077 GGATTCTGGCTTGGACCACAAGG - Intergenic
1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG + Intronic
1151005325 17:70429508-70429530 GATTTCACGGTTGGACCATCTGG + Intergenic
1167476897 19:49706439-49706461 GGATTCTCGGGTGCCACATCTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
934924969 2:98375841-98375863 GGAATCTCGGCTGTACCACCTGG + Intronic
936668742 2:114630896-114630918 GGAGTCTCGATTGAACTATCTGG + Intronic
948159346 2:235811589-235811611 TGGTTCGTGGTTGGACCATCAGG + Intronic
1172250436 20:33475737-33475759 GGATGCTGGGGTGGACCGTCTGG - Intergenic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1180617622 22:17138638-17138660 GGATGCTGGGTTTGCCCATCAGG + Exonic
953542574 3:43835019-43835041 GGAGTCTGGGTTGGACTACCTGG + Intergenic
956089595 3:65651722-65651744 GGATTCTCTCTTGGATCCTCTGG - Intronic
980363254 4:131764970-131764992 GGATTCGCGGAGGGTCCATCAGG + Intergenic
988994590 5:36702730-36702752 GGATTCTCCTTTGGAGCCTCTGG - Intergenic
1000245074 5:159442344-159442366 TGATTTTCGGTTGGACGACCAGG + Intergenic
1038000850 8:23390126-23390148 GGATTCCTGCTTGGACCAACAGG + Intronic
1040815156 8:51499959-51499981 GGATTCCCCTTTGGAACATCAGG - Intronic
1055427039 9:76206938-76206960 GGATTCTCCCCTGGACCCTCTGG - Intronic
1058633572 9:107014698-107014720 GGAGTCTGGGTTGCTCCATCTGG + Intergenic
1060888440 9:127172840-127172862 GCCTTCTCGGTTGGGCCATTGGG + Intronic
1062266029 9:135686952-135686974 GGATTCCAGGTTGGACCAGAAGG - Intergenic
1186127431 X:6429196-6429218 GCCTTCTCCGTTTGACCATCAGG - Intergenic
1201613817 Y:15873338-15873360 GGGTTTTGGGTTAGACCATCTGG - Intergenic