ID: 1148335478

View in Genome Browser
Species Human (GRCh38)
Location 17:46838047-46838069
Sequence CCCCTGTGTTGAGGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148335464_1148335478 28 Left 1148335464 17:46837996-46838018 CCACCCAAGGGAGTGAGCAGGTA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG 0: 1
1: 0
2: 4
3: 36
4: 406
1148335466_1148335478 24 Left 1148335466 17:46838000-46838022 CCAAGGGAGTGAGCAGGTACTGG 0: 1
1: 0
2: 3
3: 27
4: 183
Right 1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG 0: 1
1: 0
2: 4
3: 36
4: 406
1148335465_1148335478 25 Left 1148335465 17:46837999-46838021 CCCAAGGGAGTGAGCAGGTACTG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG 0: 1
1: 0
2: 4
3: 36
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148335478 Original CRISPR CCCCTGTGTTGAGGGGGTGG AGG Intronic
900429597 1:2595484-2595506 GTCCTGTGGTGAGGGGCTGGGGG + Intronic
900471151 1:2855583-2855605 TCCCTGAGTGGAGGGGGAGGCGG - Intergenic
900479480 1:2891206-2891228 CCTCTTTGTGGAGGGGGTGGGGG - Intergenic
901054356 1:6441856-6441878 CCCCTGTGCTGGGGGGGGGAGGG - Intronic
901454206 1:9353982-9354004 CCCCTGAGATAAGGGGGTCGGGG + Intronic
901637358 1:10676505-10676527 CCCCTTTGTTCAGAGGATGGTGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902611390 1:17599565-17599587 TTTCTGTGTTGAGGAGGTGGCGG + Intronic
903364324 1:22796562-22796584 CCCCTTTGTTTGGGGGATGGGGG - Intronic
903442906 1:23401739-23401761 CCCCTGTGTTGGAGGGTTAGAGG - Intronic
905062033 1:35148425-35148447 CCACTGTGTGTTGGGGGTGGGGG + Intergenic
905205491 1:36340784-36340806 CTCTTGTGTTTAGGGGATGGTGG - Exonic
905318456 1:37098462-37098484 ACCAAGTGTGGAGGGGGTGGAGG - Intergenic
905522111 1:38608324-38608346 CCCTGGTGTGGAGGGGCTGGGGG - Intergenic
905734218 1:40315016-40315038 ATCCTGTGTTTGGGGGGTGGGGG + Intronic
905869432 1:41394706-41394728 CCCCTCTGGGGAGAGGGTGGTGG + Intergenic
906237639 1:44221480-44221502 CCCCTCTGGTGAGGGAGAGGAGG + Exonic
906917219 1:50024096-50024118 CCCCTGTGCTCTAGGGGTGGCGG - Intergenic
907406889 1:54259124-54259146 GCCCAGGGTTGAGGCGGTGGGGG - Intronic
907454980 1:54569605-54569627 ACCCTGTGGTGAGGGGTTGGGGG - Intronic
907887492 1:58606843-58606865 CCACTGTGGTGGGTGGGTGGTGG + Intergenic
908357304 1:63335480-63335502 GCCCTCAGTGGAGGGGGTGGGGG - Intergenic
909479398 1:76115313-76115335 ACCAGGTGTTGAGGGGGAGGAGG - Intronic
910875305 1:91872953-91872975 CCCTTTTTTTGACGGGGTGGTGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913374454 1:118135160-118135182 CCCCTGTGATCAGCAGGTGGTGG + Intronic
913960063 1:143332603-143332625 CCCCTGGGTTGGGGGGTGGGTGG + Intergenic
914054419 1:144158176-144158198 CCCCTGGGTTGGGGGGTGGGTGG + Intergenic
914124727 1:144808185-144808207 CCCCTGGGTTGGGGGGTGGGTGG - Intergenic
914694757 1:150067236-150067258 CCCCTGTGTTGAGGCTGCAGAGG - Intergenic
915268618 1:154735817-154735839 GCCCTGTGCTGAGGCAGTGGTGG + Intronic
915315403 1:155026035-155026057 CAGGGGTGTTGAGGGGGTGGGGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916277901 1:163014467-163014489 TCCCAGTGTTGTTGGGGTGGGGG - Intergenic
916344321 1:163771012-163771034 CCGCTGTGTTGCTGGGGTTGGGG + Intergenic
916578281 1:166086277-166086299 ACCCTGTGCTGTGGGGATGGTGG - Intronic
918184887 1:182118378-182118400 CCCATTTGTTGAGGGGTTGAGGG + Intergenic
918612728 1:186511673-186511695 CCCCTGTGTTGCGGGTCTGCTGG + Intergenic
920515438 1:206581694-206581716 CAGCTGTGCTGAGGGGTTGGAGG + Intronic
920547398 1:206829756-206829778 CCCCAGTGGTGATGGGATGGAGG - Intronic
921422349 1:214963166-214963188 ACCTTGTGTTTTGGGGGTGGTGG + Intergenic
922910395 1:229210930-229210952 ACCATGTGTTGAGATGGTGGAGG - Intergenic
923804417 1:237243104-237243126 CTCCTGTGTTGATGGTGTGGTGG - Intronic
924064510 1:240208236-240208258 ACTCTGGGTAGAGGGGGTGGAGG - Exonic
1063380004 10:5578429-5578451 CCCGCGTGTTGGGGCGGTGGTGG - Intergenic
1063506511 10:6605052-6605074 ACCCTGGGTTGCGGGAGTGGGGG + Intergenic
1063570862 10:7213453-7213475 CTCATGGGTTGTGGGGGTGGTGG + Intronic
1065950375 10:30646028-30646050 CACTTGAGTTGAGGGGGTCGAGG + Intergenic
1067028471 10:42864656-42864678 CCCCTGGGTTGGGGGGTGGGTGG + Intergenic
1067296249 10:44976689-44976711 CCCCTGTGTGGAAGTGGTGTAGG + Exonic
1067296859 10:44979663-44979685 CCCCTGTGGTGAGGGCGCGCCGG + Intronic
1067373174 10:45703534-45703556 GCCCTGGGTCGGGGGGGTGGGGG + Intergenic
1067386602 10:45822588-45822610 GCCCTGGGTCGGGGGGGTGGGGG - Intergenic
1067447667 10:46362012-46362034 GCCCTGGGTCGGGGGGGTGGGGG + Intergenic
1067589712 10:47498748-47498770 GCCCTGGGTCGGGGGGGTGGGGG - Intergenic
1067636836 10:48006855-48006877 GCCCTGGGTCGGGGGGGTGGGGG - Intergenic
1067683609 10:48454861-48454883 CTGCTGTGTTGGGGGTGTGGTGG - Intronic
1067768506 10:49107556-49107578 TCCCTGGGTAGAGGTGGTGGTGG - Intronic
1067771231 10:49127710-49127732 TCCCTTTGTTGTGGGGTTGGGGG + Intergenic
1067876654 10:50013487-50013509 GCCCTGGGTCGGGGGGGTGGGGG + Intergenic
1069409752 10:68141068-68141090 CCCTTTTTTTGGGGGGGTGGTGG - Intronic
1070133382 10:73670870-73670892 GCCCTGGGTCGGGGGGGTGGGGG - Intergenic
1070682357 10:78457323-78457345 CCCCTGGGTTGTGGGGGAAGGGG - Intergenic
1070782422 10:79145398-79145420 GCCCTGAGTTGTTGGGGTGGGGG + Intronic
1071601105 10:86959150-86959172 CTCCCGTGTGGAGAGGGTGGGGG - Intronic
1071608289 10:87013210-87013232 GCCCTGGGTCGGGGGGGTGGGGG + Intergenic
1072613807 10:97036261-97036283 CCCCTGTGATGAGGAGGTGGTGG + Intronic
1072845468 10:98825601-98825623 CCCCGGGGTTGGGGGGGCGGGGG + Intronic
1074765228 10:116695303-116695325 CAACTGTGTTGAGTGGGAGGTGG + Intronic
1075452596 10:122562418-122562440 CCCCTGTGATGAGTGTGTGGAGG + Intronic
1075467480 10:122662420-122662442 CCCCAGTGTGGAGGGGGCCGAGG - Intergenic
1075778362 10:125002171-125002193 CCCCTGCATTTTGGGGGTGGGGG - Intronic
1075920365 10:126206843-126206865 CCCATGTGTTGTGGGGGCGGGGG + Intronic
1076833499 10:133008477-133008499 CCGATCTGGTGAGGGGGTGGCGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077057554 11:602263-602285 TGTCTGTGTTGATGGGGTGGAGG + Intronic
1077063086 11:626245-626267 CCCCTGTGTAGCGGGGCTGAGGG - Intergenic
1077336467 11:2007107-2007129 CCCCTGTGTTTTGGGATTGGAGG + Intergenic
1077811715 11:5644682-5644704 ACCGTGTGTCGGGGGGGTGGTGG + Intronic
1077897846 11:6467093-6467115 TCCCTGTGGTGGGGAGGTGGTGG + Intronic
1079125172 11:17713957-17713979 ACCCAGTGTGCAGGGGGTGGGGG - Intergenic
1080685690 11:34513229-34513251 TCTCTGTATCGAGGGGGTGGGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081268959 11:41060986-41061008 CACCTGTGTGGAGGGGGGAGGGG - Intronic
1081650519 11:44820694-44820716 CCCCAGTGTTGGAGGTGTGGTGG + Intronic
1083163164 11:60867881-60867903 TTTCTGTGGTGAGGGGGTGGGGG - Intronic
1083784717 11:64937490-64937512 CCCAGGTCTTGAGGGGATGGGGG - Intergenic
1083922444 11:65787960-65787982 CACCAGTGTTGTGGGGGAGGAGG - Intronic
1084111259 11:67015451-67015473 CCCTGGTGTGGAGGCGGTGGTGG + Intronic
1084187825 11:67484183-67484205 CCCATGTGCTGGGGGGTTGGTGG + Intronic
1084978180 11:72814573-72814595 CCCCGGTGCTGAGAGGATGGCGG + Intronic
1085640149 11:78188415-78188437 CGCCTGTGGTGCGGGGGAGGGGG - Intronic
1086437537 11:86797224-86797246 CCCCAGTGGGGAGGGGGTCGGGG - Intronic
1087465620 11:98500971-98500993 CCCCTTTGTAGAGAGGGTGCTGG + Intergenic
1087812826 11:102626557-102626579 CCCATGTGTTGAGGGAGGGAGGG + Intergenic
1089328474 11:117673689-117673711 CCACTGGGTTGAGGAGGTGGGGG + Intronic
1089392513 11:118111763-118111785 CCCCCGTGTGGTGGGTGTGGAGG + Exonic
1089518592 11:119049082-119049104 CCCTTAGGTTCAGGGGGTGGGGG + Exonic
1090424115 11:126595170-126595192 CCCACTTGTGGAGGGGGTGGCGG + Intronic
1202819451 11_KI270721v1_random:62289-62311 CCCCTGTGTTTTGGGATTGGAGG + Intergenic
1091750386 12:3018473-3018495 GCCCTGTGGTGTGGGGGTGGGGG - Intronic
1091976912 12:4832909-4832931 CCCCTGAGGTGAGGGTTTGGTGG - Intronic
1092229852 12:6770296-6770318 TCCCTGTGTGGCAGGGGTGGGGG + Intronic
1092272792 12:7036965-7036987 CCCCTGTGTTGACTGGGTTTGGG + Intronic
1094565527 12:31595202-31595224 CCTCTTTTTTGGGGGGGTGGCGG + Intergenic
1094641875 12:32283776-32283798 CACCTGTGTTGAGAAGGTTGAGG + Intronic
1095600114 12:44003720-44003742 GCCATGTGCTGAGGAGGTGGTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096997808 12:55849898-55849920 CACCTGTTTTGATGGGGTGGGGG + Intergenic
1097137940 12:56875084-56875106 CCCAGAGGTTGAGGGGGTGGGGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097204877 12:57312396-57312418 CTCCTGCGTTCAGGGAGTGGTGG + Intronic
1097803509 12:63940477-63940499 GCCATGTGTTAAGGGGGTGGGGG + Intronic
1099246958 12:80203479-80203501 CATCTTTGTTGAGGGGGTGGAGG + Intergenic
1099285355 12:80708930-80708952 CCCCTGCGTGGAGGAAGTGGTGG + Exonic
1099521346 12:83667923-83667945 CAGGTGTGTTGAGGGGGGGGAGG - Intergenic
1100156341 12:91804558-91804580 CCACTGTGTTGAGCTGCTGGGGG - Intergenic
1100549459 12:95633507-95633529 CCTCTGTGATGTGGGTGTGGTGG + Intergenic
1102019964 12:109675531-109675553 CTCCTGGGTTTGGGGGGTGGGGG + Intergenic
1103201839 12:119094203-119094225 CGCCTGTGGAGAGGGAGTGGTGG + Intronic
1104811410 12:131622263-131622285 GCCCTGTGTGGCTGGGGTGGGGG + Intergenic
1104926886 12:132318488-132318510 GCCCTGTGCTGATGGGATGGCGG - Intronic
1106250197 13:27977105-27977127 TCCCTGTGTTGGGGGGGGCGGGG + Intergenic
1107028863 13:35830796-35830818 CCCCTTTGTGGAGGTGGTGAAGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108006564 13:45953270-45953292 CCACTGGGTGGAGGGGATGGGGG - Intergenic
1110011798 13:70345313-70345335 CCCTGGTTTTGGGGGGGTGGGGG - Intergenic
1112778024 13:102866568-102866590 CCCCTGTGCTCAGGGCCTGGCGG + Intronic
1112847047 13:103656338-103656360 CCCCAGTTTGGAAGGGGTGGGGG - Intergenic
1113436313 13:110294257-110294279 ACCCTGTGTGAAGGGGCTGGAGG - Intronic
1113490522 13:110688154-110688176 CCGCTTTGGTGAGTGGGTGGGGG - Intronic
1113614449 13:111670825-111670847 GGTCTGTGTGGAGGGGGTGGCGG + Intronic
1113619917 13:111755739-111755761 GGTCTGTGTGGAGGGGGTGGCGG + Intergenic
1113707465 13:112444042-112444064 CCCCTGTGTTTAGCGGGGTGAGG - Intergenic
1115556188 14:34546655-34546677 ACCGTGTGTTGAGAGTGTGGTGG + Intergenic
1115557720 14:34556426-34556448 ACCGTGTGTTGAGAGTGTGGTGG - Intergenic
1115650513 14:35399534-35399556 CACCTGTGTTGAGGTGCTTGGGG + Intergenic
1116003255 14:39266830-39266852 CCCCTGGGTCGGGGGGGTGGGGG + Intronic
1117837171 14:59819500-59819522 CTCCAGAGTTGAGGGGGTGGGGG - Intronic
1118141887 14:63093051-63093073 CCTCTCTGTGGAGGGGGTGAAGG - Intronic
1118456803 14:65952104-65952126 CCCCTCTGTGGGGGTGGTGGAGG + Intergenic
1120019915 14:79517093-79517115 CCCATTCGTTGAGGGGGGGGGGG - Intronic
1120035338 14:79690725-79690747 CTTCTGTGTTGTGAGGGTGGGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121312976 14:92945099-92945121 CCCCTGTCTGGAGGAGGCGGAGG - Intronic
1122292897 14:100688890-100688912 CCCCTGTGTTTGCGGGGTGAGGG + Intergenic
1122745287 14:103894147-103894169 AGCCCGTGTGGAGGGGGTGGGGG + Intergenic
1124202922 15:27693845-27693867 CCGCAGTCTTGAGGGGGTGCAGG - Intergenic
1124843075 15:33263051-33263073 TCACTGAGTTGAGGTGGTGGTGG - Intergenic
1124956487 15:34363736-34363758 CCTCTGCCTTGTGGGGGTGGGGG - Intronic
1126700323 15:51360833-51360855 CCCCTGTGTGGAGGGAGGAGAGG + Intronic
1127251929 15:57247779-57247801 CTCTTGTGTTGAAGAGGTGGAGG - Intronic
1129323736 15:74788870-74788892 ATCCTGTGCTAAGGGGGTGGGGG + Intronic
1129891969 15:79077545-79077567 CCACTGTCCTGAGGGCGTGGTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130576492 15:85097452-85097474 CCCCTGTATATAGGGTGTGGAGG - Intronic
1132057280 15:98661909-98661931 CCCCAGTGTTGTGGGGAAGGAGG - Intronic
1132560699 16:592284-592306 CCCCCGAGTTGAGAGAGTGGGGG - Intronic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1132735553 16:1384205-1384227 CCACCGTGTTGGGGTGGTGGGGG - Intronic
1133046154 16:3089459-3089481 CCCCTGTGTGGATGCGCTGGTGG + Exonic
1133076744 16:3285797-3285819 CCCCTGAGTGTTGGGGGTGGGGG + Intronic
1133718479 16:8471784-8471806 CATCTGTGTGGAGGGGGTGATGG - Intergenic
1133917527 16:10122596-10122618 CCCATTTTTTGGGGGGGTGGGGG - Intronic
1134039015 16:11053656-11053678 CCCCTGTGGACAGGGCGTGGTGG - Intronic
1134486816 16:14665233-14665255 TACCTGTGTTTTGGGGGTGGGGG + Intronic
1135332785 16:21574621-21574643 CTCGTGTGTTGGTGGGGTGGGGG - Intergenic
1136419921 16:30125422-30125444 CCCTTTTTTTGGGGGGGTGGGGG - Intergenic
1136878742 16:33885410-33885432 TCCCTTTGTTGGGGAGGTGGGGG + Intergenic
1138085383 16:54129032-54129054 CCCAGCTGCTGAGGGGGTGGAGG + Intergenic
1138139593 16:54556960-54556982 CACTTGAGTTGAGGAGGTGGAGG - Intergenic
1139727603 16:68914029-68914051 CACCTGAGTGGAAGGGGTGGAGG - Intronic
1139802054 16:69530749-69530771 CACATGTGATGCGGGGGTGGGGG + Intergenic
1141424318 16:83935490-83935512 CCGCTGTGTGGAGGGTGTGTTGG + Intronic
1141680068 16:85538650-85538672 CCCCTGTGGGGAGGAAGTGGAGG + Intergenic
1141882619 16:86869787-86869809 CCCGTGTGTTCGGGGCGTGGAGG - Intergenic
1142613168 17:1120203-1120225 CAGCTGTGATGAGGGGGAGGAGG + Intronic
1143032618 17:3976371-3976393 CTCCTGTGTGCAGGGGCTGGGGG + Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1143241004 17:5443233-5443255 CCCCTGGTCAGAGGGGGTGGGGG - Exonic
1143712468 17:8744156-8744178 CCCCAATGTTGAGGGGGCGTCGG - Exonic
1143774159 17:9186700-9186722 GGCCTGTGTGGTGGGGGTGGGGG + Intronic
1143978572 17:10848156-10848178 TCCCAGTGTTGGGGTGGTGGAGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145769643 17:27483994-27484016 TCCCTGTGTTGCAGTGGTGGAGG + Intronic
1146947425 17:36883472-36883494 CCTCTGTGGTGGGAGGGTGGGGG + Intergenic
1147335209 17:39723518-39723540 CAGCTGGGGTGAGGGGGTGGTGG - Exonic
1147375221 17:40018986-40019008 CTCCTGTGGTGAGGAGGAGGAGG - Intergenic
1147388721 17:40096632-40096654 CCTCTGTGTCCAGGGGGAGGGGG + Intronic
1147672170 17:42182828-42182850 CCCCTATCTTCTGGGGGTGGGGG + Intergenic
1147948306 17:44092804-44092826 CCCCTGGGGTGGGGGGGGGGTGG + Exonic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1148574524 17:48700111-48700133 ACCCTGTATTGAGGAGGAGGAGG + Intergenic
1148755279 17:49969865-49969887 TCCCTGGGATGTGGGGGTGGGGG + Intronic
1149153293 17:53594998-53595020 CCTCTGCTTTCAGGGGGTGGGGG + Intergenic
1149290390 17:55212906-55212928 TCCGTGTGTTGGTGGGGTGGTGG - Intergenic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1151308437 17:73278957-73278979 CCCAAGTGTGGAGGGAGTGGGGG + Intergenic
1151450312 17:74194710-74194732 CACCTGTGCTGAGGGGCTGCTGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1151939746 17:77285153-77285175 CTCCAGTGCTGAGGGGCTGGGGG - Intronic
1152412646 17:80136507-80136529 CCCCTGTGCAGAGGGGCTGTTGG + Intronic
1152684854 17:81688927-81688949 TCCCTGTGTTGGGAGGGAGGAGG + Intronic
1152878735 17:82803603-82803625 CCCCTGCGGGGAGGAGGTGGAGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153484099 18:5578094-5578116 CTCCAGGGTTGGGGGGGTGGCGG + Intronic
1153744421 18:8162586-8162608 CACCTGTGTTGAGGAGGTAGCGG - Intronic
1153785007 18:8526502-8526524 CCTCTCTGTCGAGTGGGTGGTGG - Intergenic
1155035100 18:22019385-22019407 CATCTGTGCTGAGGGGGTGGCGG + Intergenic
1156383105 18:36581763-36581785 CCCCAGTGTTGGGGGTGGGGTGG - Intronic
1156438713 18:37162240-37162262 CCCTTTTTTTGTGGGGGTGGGGG + Intronic
1156683307 18:39616897-39616919 CCCCTGTGTCTGGGGGGAGGGGG + Intergenic
1158514312 18:58118797-58118819 CCCCTGTGTCCTGTGGGTGGGGG + Intronic
1158713454 18:59857739-59857761 CCCCTGTGATGAGGGGAAAGGGG - Intergenic
1159351712 18:67283788-67283810 CATCTGTGTAGAGGGGCTGGAGG + Intergenic
1159949279 18:74468644-74468666 CCTCTGTGTGGAGGAGATGGAGG + Intergenic
1159970492 18:74646835-74646857 CCCCTGTGAGGAGGAGCTGGGGG - Intronic
1160866137 19:1256938-1256960 CCTCTGTGTTCAGCAGGTGGAGG + Intronic
1161473761 19:4473566-4473588 GCCCAGTTTTGAGGGGCTGGGGG + Intronic
1161509423 19:4662410-4662432 CCCCGGTGGGGAGGGGGTCGGGG - Intronic
1161969876 19:7572094-7572116 CCACTGTTTTGAGGCGGGGGGGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163695103 19:18760050-18760072 CCCCTGTGTTGTGGGTGGCGGGG - Exonic
1163979950 19:20889825-20889847 CCACTGTGATGAGTGAGTGGGGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165069470 19:33247398-33247420 CTCCTGGGCTGAGGGGATGGGGG - Intergenic
1165423210 19:35732448-35732470 CCCAGGTCTTCAGGGGGTGGTGG - Exonic
1165946661 19:39447164-39447186 CCCCTTTTTTTAGGGGGTGGTGG - Intronic
1167881796 19:52465287-52465309 TCACTGGGTTGAGGAGGTGGTGG + Intronic
1168277223 19:55284727-55284749 TCCCTGGATGGAGGGGGTGGGGG + Intronic
1202693898 1_KI270712v1_random:110854-110876 CCCCTGGGTTGGGGGGTGGGTGG + Intergenic
925125495 2:1452847-1452869 CCCCTAAGTTGAAGGGGTGTAGG - Intronic
925756673 2:7139394-7139416 CCCACCTGTGGAGGGGGTGGAGG + Intergenic
926331010 2:11825247-11825269 CCACTGTGTTCAGAAGGTGGTGG - Intronic
926332773 2:11838714-11838736 CCCCTGTGCTGGGAGGCTGGAGG + Intergenic
926919946 2:17930458-17930480 CCCCTGTGATGAGTGTGTTGGGG + Intronic
927713664 2:25340447-25340469 CCCCAGCGATGAGGGGCTGGGGG + Intronic
928282933 2:29964497-29964519 GCCCTGAGTTAAGGGGTTGGGGG + Intergenic
930040750 2:47121126-47121148 CACCTGTGCGGTGGGGGTGGGGG + Exonic
930252676 2:49053044-49053066 CCCCAGTGATCTGGGGGTGGAGG + Intronic
930879685 2:56257217-56257239 CCACTGTGTTGGGGAGATGGTGG + Intronic
931117778 2:59183087-59183109 CCCCTGTGTTGTAGGAGTTGAGG - Intergenic
931185323 2:59945384-59945406 CTGTTTTGTTGAGGGGGTGGAGG + Intergenic
931489077 2:62725153-62725175 CCACTGTGCTGTGGCGGTGGGGG + Intronic
931993967 2:67822376-67822398 CCCAGGAGTTGAGGGAGTGGAGG + Intergenic
932619612 2:73257990-73258012 CCTCTGTGCTGAGGCCGTGGAGG - Exonic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
932883610 2:75527419-75527441 CCCCAGTGGAGAGGGGGAGGGGG - Intronic
933952663 2:87343721-87343743 CCCCTGGGTTGGGGGGTGGGTGG - Intergenic
934477665 2:94603977-94603999 CCTGTGTGTTGAGGGGTGGGGGG + Intronic
934767005 2:96885316-96885338 CTCCTGTTCTGAGGGCGTGGAGG - Intronic
936407630 2:112221204-112221226 CCCCAGTGTTGAAGGTGGGGAGG + Intronic
937225088 2:120364089-120364111 GCCCAGTGTTCTGGGGGTGGGGG + Intergenic
937322678 2:120970408-120970430 CCACGGGGTTGATGGGGTGGGGG - Exonic
938079643 2:128362896-128362918 ACCCTGTCTTGGGAGGGTGGGGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941631626 2:167891126-167891148 TTCCTGTGTTGTGGGGATGGGGG + Intergenic
942083363 2:172422524-172422546 CTCCTGTGTTGGTGGGGTGGGGG - Intergenic
943647883 2:190427273-190427295 CACCTTAGTTGAGGGGTTGGGGG + Intronic
944412261 2:199456958-199456980 CCCCTGGATTGGGGGGGTGGGGG + Intronic
945201028 2:207281650-207281672 CCCTGGTGTTCAGGGGGAGGAGG + Intergenic
947137291 2:226987852-226987874 AATCTGTGGTGAGGGGGTGGAGG + Intronic
947286348 2:228519765-228519787 CCTCTGTGGTGGTGGGGTGGAGG - Intergenic
948133984 2:235621904-235621926 CCGCTGTTCTGAGGGGGTGGGGG - Intronic
948568561 2:238901890-238901912 GCCCAGGGTTGAGGGTGTGGTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168808460 20:687037-687059 CCATTCTGTTGAGGGTGTGGTGG + Intergenic
1169932460 20:10849081-10849103 CCCCTGTATAGAGGGGCTGCTGG + Intergenic
1170775507 20:19371593-19371615 TCCCTGTATGTAGGGGGTGGTGG - Intronic
1171183928 20:23111519-23111541 CCTCTGTGGTGAGGGGCAGGAGG - Intergenic
1171218292 20:23369648-23369670 CCCCTGTGTGGATGCGGCGGTGG - Exonic
1172614589 20:36274859-36274881 CACCTGTGGGTAGGGGGTGGGGG + Intergenic
1173227912 20:41172656-41172678 CCCCTGTGAGGAGGGTGAGGAGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173857825 20:46262210-46262232 TGTGTGTGTTGAGGGGGTGGGGG + Intronic
1173950214 20:46986857-46986879 CCCCAGTGTTGTGGGGCTAGTGG - Intronic
1174328993 20:49802783-49802805 CACCTGTGTTGAGGGTGTACCGG + Intergenic
1175132872 20:56802791-56802813 CCCCTTTGTGGAGGGGGTCAAGG + Intergenic
1175575869 20:60060412-60060434 CACCTGTGTGGAGCGTGTGGTGG - Intronic
1175732400 20:61362710-61362732 CCCCTGGCTGGATGGGGTGGGGG + Intronic
1175769761 20:61616288-61616310 CCTCTGTGTGGGGCGGGTGGAGG + Intronic
1176072406 20:63234124-63234146 CCGCTGTGCTGAGGGGGCGGTGG + Intergenic
1176168915 20:63688395-63688417 CCCCTGTGTTCTGGGCGGGGTGG + Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1179010224 21:37550894-37550916 CCTGTGTGTTGGGGGGGTGGGGG + Intergenic
1179038655 21:37782565-37782587 CCCCTGGGTGGAGGGAGTTGTGG - Intronic
1179617946 21:42593802-42593824 GCCCTGGGAGGAGGGGGTGGCGG - Intergenic
1181500613 22:23313652-23313674 CTCCTCTGGGGAGGGGGTGGTGG + Intronic
1181742471 22:24932489-24932511 CCCCAAAGTTGAGGGGGTGCTGG - Intergenic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1182395891 22:30035712-30035734 ACCCAGTGTTGGGGTGGTGGGGG - Intergenic
1183036443 22:35144261-35144283 CCCCGCTGTGGAGGGGGTGGGGG + Intergenic
1183268926 22:36848876-36848898 ACCCTGTGGCGGGGGGGTGGGGG - Intergenic
1184385709 22:44173375-44173397 CCCCTGTGTGGCGGAGATGGTGG + Intronic
1184594706 22:45506732-45506754 CCCCAGTGGTGAGGAGGGGGTGG - Intronic
1184606343 22:45576812-45576834 CCCCTGTGTGGGGAGGGTGGAGG - Intronic
1184632087 22:45789664-45789686 CCCCTTTGTGGTGGTGGTGGTGG + Intronic
1184802857 22:46773159-46773181 GGCCTGTGTTCAGGGGGTGAAGG - Intronic
1185247524 22:49781082-49781104 CTCCTGTGTTGATGGGGCAGCGG - Intronic
950483527 3:13259428-13259450 CCACTGTTTTGATGGGGTGCAGG - Intergenic
950681584 3:14588814-14588836 CCCCTGTGTGGGAGGTGTGGGGG - Intergenic
951251176 3:20395742-20395764 CTCCTGGGTTGAGGGGTTGCGGG + Intergenic
951590176 3:24255895-24255917 CCACTGTGTTGAGGGGGTGAGGG + Intronic
952978480 3:38716291-38716313 CCCATGTGTTGTGGGAGGGGAGG + Intronic
954300760 3:49699648-49699670 CTCCTGTGTGGAGGGGGAGGAGG - Exonic
954371378 3:50171145-50171167 CCCCTGGGTGGAGGTGGGGGTGG - Intronic
954701298 3:52452250-52452272 ACTCTGTGTTCAGGGGTTGGGGG + Exonic
955060700 3:55489436-55489458 CCTCTGGGGTGTGGGGGTGGAGG - Intronic
955381209 3:58439849-58439871 ATCCAGTGTTAAGGGGGTGGTGG + Intergenic
958864546 3:99485745-99485767 GCAATGTGTTGGGGGGGTGGTGG - Intergenic
959665052 3:108911290-108911312 CTGCTTTTTTGAGGGGGTGGGGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960949533 3:122990216-122990238 CTCCTCTGCTGAGGGGGAGGTGG + Intronic
961006709 3:123410354-123410376 CTGCTGTGTTGAGGAGGAGGAGG - Intronic
961192833 3:124976658-124976680 CCCCAGTGTGGAGGTGCTGGGGG + Intronic
961265105 3:125635271-125635293 ACCCTGGGTGGAGGGGGGGGCGG - Intergenic
961462732 3:127062979-127063001 CCACCGTGGTGTGGGGGTGGTGG + Intergenic
961511900 3:127408542-127408564 GCCCTGAGTGGACGGGGTGGTGG - Intergenic
961566030 3:127763789-127763811 CCCCTGTGTGGGGGAGGGGGAGG + Intronic
964148707 3:153497937-153497959 CCACTGTGCTGAGCGGGTAGTGG - Intronic
965737847 3:171840782-171840804 CCCCTGGGTTGAGGAGAAGGTGG + Intergenic
968662915 4:1806183-1806205 GCCCTGGGGTGCGGGGGTGGGGG + Intronic
968746320 4:2362447-2362469 CCCCAGTGGTGGAGGGGTGGAGG - Intronic
968814074 4:2812726-2812748 CGCATGTGATGGGGGGGTGGGGG - Intronic
968921353 4:3523845-3523867 CCCCACTGTGGTGGGGGTGGGGG - Intronic
969134438 4:5019264-5019286 CCCCTGTCCTGAGCGGGCGGGGG + Intronic
969893039 4:10277240-10277262 TCCCTGTGTTTAGGGGGAAGAGG + Intergenic
973650107 4:52990895-52990917 ACCCTGGGCTGAGGTGGTGGTGG + Intronic
976507799 4:85869515-85869537 ACCCTGTTTGGATGGGGTGGGGG + Intronic
977318792 4:95484445-95484467 CCACTGTGTAGATGGGGTTGAGG + Intronic
978903447 4:113979755-113979777 CCCCCGGGAAGAGGGGGTGGGGG + Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
980032497 4:127846331-127846353 CTCCTGTGTGGCTGGGGTGGAGG - Intergenic
981615213 4:146638313-146638335 CACCTGAGCTGACGGGGTGGGGG + Intergenic
984871226 4:184326985-184327007 CTCCTGTGTTCAGTGGTTGGGGG - Intergenic
985478193 5:91618-91640 ACCCTGAGTTGTGGGGGGGGAGG + Intergenic
985632524 5:1021422-1021444 GCCCTGTGGGGAGGGGCTGGGGG - Intronic
985990920 5:3560585-3560607 GCCCAGTGTTGTGGGAGTGGAGG - Intergenic
986167895 5:5291655-5291677 GCCTTGTGGTGTGGGGGTGGGGG - Intronic
986843438 5:11724553-11724575 CTCCTCTGTTGTGGAGGTGGTGG + Intronic
986885905 5:12235604-12235626 CCCATGTGTGGAGGGGGTCCTGG + Intergenic
989161728 5:38397787-38397809 CCCCTTTGCTCATGGGGTGGGGG - Intronic
991639794 5:68740852-68740874 CTCCTTTGTTGGGGGGTTGGAGG + Intergenic
991985195 5:72277928-72277950 CCTGTGAGATGAGGGGGTGGAGG + Intronic
992167692 5:74071199-74071221 ACCCTGTCTTGGGGGGGCGGGGG - Intergenic
997724838 5:136111976-136111998 CCCCAGTGTTGGGGGGTGGGTGG + Intergenic
998481866 5:142469666-142469688 CGCCTGTGTTGAGGAGGCTGGGG + Intergenic
998526499 5:142847731-142847753 CACCTGTGTTGTATGGGTGGTGG + Intronic
1001314021 5:170630025-170630047 GGCCTGGGGTGAGGGGGTGGGGG + Intronic
1001397774 5:171429113-171429135 GCCCGGGGTTGAGGAGGTGGGGG + Intronic
1001872097 5:175165485-175165507 TGTGTGTGTTGAGGGGGTGGGGG - Intergenic
1001919200 5:175587304-175587326 TGCCTGTGATGTGGGGGTGGGGG + Intergenic
1001939824 5:175732611-175732633 CCCCTGTGCTCAAGGGGAGGTGG - Intergenic
1002101887 5:176861877-176861899 CCCCTGAGAGGATGGGGTGGGGG - Intronic
1002344273 5:178536791-178536813 GGCATGTGCTGAGGGGGTGGAGG + Intronic
1002795310 6:466821-466843 TCCCTGTGGTCAGGGGATGGTGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004321397 6:14634213-14634235 CACCTGAGTCGGGGGGGTGGGGG + Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004854106 6:19731967-19731989 CCCCTGTGGATAAGGGGTGGGGG + Intergenic
1005051952 6:21692936-21692958 CCCCTTTGCTGTGGGGGTGAGGG + Intergenic
1005206320 6:23409501-23409523 CCCCTGTGTGGAAGGTGTGTGGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006174732 6:32115097-32115119 CCCCAGAGTTGCAGGGGTGGGGG + Intronic
1006406752 6:33849963-33849985 GCCCTGGGGAGAGGGGGTGGTGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1008485728 6:52033349-52033371 ACTCTGTGTTGTGGGTGTGGGGG - Intronic
1009951571 6:70402937-70402959 CCTGTGTGTGGGGGGGGTGGGGG - Intergenic
1011297694 6:85841220-85841242 TCCCTGTGGGGTGGGGGTGGGGG + Intergenic
1011498720 6:87964926-87964948 CCACTGTGCTGAGTGGGTTGAGG + Intergenic
1013014584 6:106149757-106149779 AACTTGTGTTGAGGTGGTGGTGG + Intergenic
1013765062 6:113564915-113564937 CATTTGTGTGGAGGGGGTGGGGG - Intergenic
1018442452 6:163825571-163825593 CCCCTGATTTAAGGGAGTGGAGG + Intergenic
1018570435 6:165204140-165204162 CCCATGTGTTGAGGGAGGGAGGG - Intergenic
1020217785 7:6207940-6207962 ACCCTGTCTTGGGGGGGTGGGGG + Intronic
1021540700 7:21754568-21754590 GTCCTGTGATGATGGGGTGGGGG - Intronic
1022384787 7:29890767-29890789 GCCCTGTGTTCAGGTGGAGGGGG + Intronic
1023866399 7:44240452-44240474 CGCTCGTGTTCAGGGGGTGGAGG + Intronic
1023873834 7:44276432-44276454 CCCCTTTGTGCAGTGGGTGGCGG - Intronic
1023878453 7:44305609-44305631 CCCCTGTGAGGTGGGGGAGGTGG + Intronic
1024896075 7:54263676-54263698 CAGCTTTGTTGAGGGGTTGGGGG + Intergenic
1026009901 7:66628742-66628764 TCCCTGGGTTGGGGGGGGGGGGG - Intergenic
1026017105 7:66680210-66680232 TACCTGTGCTGAGGAGGTGGAGG - Intronic
1026025177 7:66738916-66738938 TACCTGTGCTGAGGAGGTGGAGG - Intronic
1027573893 7:79907458-79907480 CCTGTATGTTGAGGTGGTGGTGG + Intergenic
1033213178 7:139475552-139475574 TCCCCGTGCTGGGGGGGTGGCGG + Intronic
1033238354 7:139656286-139656308 GCCCCGTTTTGTGGGGGTGGAGG - Intronic
1034259451 7:149745675-149745697 GCTCTCTGTTGAGGGGCTGGTGG + Intergenic
1034615333 7:152411449-152411471 ATTGTGTGTTGAGGGGGTGGGGG - Intronic
1035424984 7:158764640-158764662 CTGCTGTGTTGCTGGGGTGGTGG - Intronic
1036906994 8:12715570-12715592 CTCCTGTGATGGGGGGGGGGGGG - Intergenic
1037153245 8:15665943-15665965 CCTCCGTGTTTAGGGGGTGAGGG - Intronic
1037538576 8:19850897-19850919 CACATGTGTGGAAGGGGTGGTGG - Intronic
1037916820 8:22777979-22778001 CCCCTCTGTGCAGGGGCTGGTGG - Intronic
1038036575 8:23691361-23691383 TCCCTGTGGTGAGGGGCTGTAGG + Intergenic
1039398436 8:37247368-37247390 CCCCTGTGAGGAAGGGGTGGAGG - Intergenic
1039550633 8:38440539-38440561 CCCCTGGGTCGGGGGGCTGGTGG - Intronic
1041090533 8:54297317-54297339 CCCCTGAGTGGAGGTGGAGGTGG + Intergenic
1042816389 8:72882176-72882198 CCCCCGTGTGGAGGTGCTGGTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045376930 8:101583499-101583521 GCCAAGTGTTGAGGGAGTGGAGG + Intronic
1045673909 8:104588389-104588411 ACCCCGGGTTGAGGGGGCGGGGG + Intronic
1046082939 8:109394502-109394524 TCACTCTGTTGCGGGGGTGGTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046692752 8:117304218-117304240 CACCGGCGGTGAGGGGGTGGGGG - Intergenic
1046957029 8:120072331-120072353 CCACTGTGGTGAGTGTGTGGTGG + Intronic
1047407945 8:124600975-124600997 TTCCTGTTTTGAAGGGGTGGGGG - Intronic
1048015211 8:130491062-130491084 GCCCTGCCTTGTGGGGGTGGTGG + Intergenic
1048896474 8:138996999-138997021 CCCGTGTGCTTAGGGGGTTGGGG - Intergenic
1048977584 8:139681605-139681627 ACCCTGTGCTGAGGGGCTGCAGG + Intronic
1049172585 8:141170927-141170949 GCACTGTGTGGCGGGGGTGGGGG - Intronic
1049222414 8:141434121-141434143 CCCAGGTGTTGGGGGGGTGGGGG + Intergenic
1049299746 8:141863199-141863221 GCCCTGCGTTGTGGGGGTGGTGG - Intergenic
1049551338 8:143261362-143261384 CCCCAGAGCTGAGGCGGTGGTGG + Intronic
1050508087 9:6368353-6368375 GCCCTGGGATGAGGGAGTGGTGG - Intergenic
1052165726 9:25325537-25325559 CTTCTGTGTTGGGGGGCTGGGGG - Intergenic
1052852292 9:33385579-33385601 CCTGTGTGTTGAGGGGTGGGGGG - Intronic
1053010116 9:34628126-34628148 CCCCTGTGTTGGGGGGCTCTGGG - Intergenic
1055670449 9:78600280-78600302 TCCCTCTATTGAAGGGGTGGTGG + Intergenic
1057891016 9:98869922-98869944 CCCTTCTGTTGGCGGGGTGGAGG - Intergenic
1058393879 9:104526961-104526983 CACCAGTGTTGAGGGAATGGAGG + Exonic
1058575987 9:106401798-106401820 CCTCTGTGTTGAGGGTGTTGAGG - Intergenic
1059723323 9:116982935-116982957 CCTCTGTGCTGCTGGGGTGGAGG - Intronic
1060849065 9:126860290-126860312 CCCCAGTGCTGGGGGGGTCGAGG + Intergenic
1061816044 9:133197202-133197224 CCCCAGAGGTGAGGGGCTGGGGG + Intergenic
1061910458 9:133719629-133719651 CTCCTGGGGTGGGGGGGTGGGGG - Intronic
1062060576 9:134493203-134493225 CCCCGGTGTTTGGGGGATGGGGG + Intergenic
1203768024 EBV:36504-36526 TCCCTGCGCTGAGGTGGTGGGGG - Intergenic
1185673119 X:1827078-1827100 CCCCAGTGTTGGGGGGGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187993620 X:24902119-24902141 CAGGTGTGTTGAAGGGGTGGTGG + Intronic
1189198104 X:39168453-39168475 CCCCTGTGTGGGGGATGTGGGGG + Intergenic
1190109132 X:47578696-47578718 CAGCTGTGCTGTGGGGGTGGGGG - Intronic
1193049737 X:77087316-77087338 CCTATATGTTGAGGAGGTGGGGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194974565 X:100380434-100380456 CCCCTGCCTTCATGGGGTGGGGG - Intronic
1196535388 X:116837972-116837994 CACATGTGTTGAGGTGGTGGTGG - Intergenic
1199330439 X:146552156-146552178 CCCCTGTGTTGTGGTGGTGGGGG - Intergenic
1200173178 X:154094124-154094146 CCCCTTTGATGTGGGGGTGGGGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200814597 Y:7518369-7518391 CTCCAGTCTTGAAGGGGTGGAGG + Intergenic
1201764846 Y:17566873-17566895 CCCCTGTGTTGGGGCCGGGGTGG - Intergenic
1201836706 Y:18339116-18339138 CCCCTGTGTTGGGGCCGGGGTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic