ID: 1148336286

View in Genome Browser
Species Human (GRCh38)
Location 17:46843634-46843656
Sequence CCAGCTAGTAAGCTTAGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148336286 Original CRISPR CCAGCTAGTAAGCTTAGAAC CGG (reversed) Intronic
903840609 1:26236432-26236454 CCAGTTATAAAGCTTAGAAAGGG - Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
908864866 1:68536240-68536262 CCAGCTACTAAGCATACTACTGG - Intergenic
910419607 1:87044216-87044238 TCAACTAGAAAGCTAAGAACTGG - Intronic
911596625 1:99805253-99805275 CCAGAGAAAAAGCTTAGAACAGG - Intergenic
912374477 1:109199173-109199195 TCAGCTATTAACCTCAGAACTGG - Intronic
914788208 1:150852401-150852423 TCAGCTGGTCAGCTGAGAACTGG - Intronic
917449086 1:175131819-175131841 ACAACTAGTAAGTATAGAACTGG + Intronic
919852092 1:201679707-201679729 CCAGCTAGTAAGTTTTGGAAAGG + Intronic
924093450 1:240525773-240525795 TAAGATAGTAAGATTAGAACTGG - Intronic
1065777394 10:29133540-29133562 CCAGCAAGTCAGCTTAGGAAAGG + Intergenic
1071931184 10:90472253-90472275 TCAGCTACTAAGCTAAGAAAAGG - Intergenic
1073093682 10:100967170-100967192 CCAGCTGGTAAAATAAGAACGGG - Intergenic
1074568693 10:114604930-114604952 CCAGCTACCAAGCTCAGAACTGG + Intronic
1083060512 11:59865560-59865582 CCACCTAGTAATCTTTGGACTGG + Intronic
1084718174 11:70887079-70887101 CCAGCTGATAAGCTTTGGACTGG - Intronic
1091415805 12:282545-282567 CCAGCTAGAAAGCTAACTACTGG + Exonic
1091671277 12:2453891-2453913 CCAGAAAGGAAGCTGAGAACTGG - Intronic
1092288684 12:7145274-7145296 CCATGTAGTAACCTTAGAAATGG - Intronic
1100000057 12:89822871-89822893 CCAGATAGTGAGCATAGTACAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1107157839 13:37190489-37190511 CCAGGTACTATGCTTAGTACCGG + Intergenic
1107876702 13:44797065-44797087 CCAATTAGTAAGCTTGGCACAGG + Intergenic
1109036466 13:57268151-57268173 ACAGGTAGTAAGCATAGTACCGG + Intergenic
1120311296 14:82831600-82831622 CCTGTAAGTAAGCTTAGAAGTGG - Intergenic
1122340937 14:101028114-101028136 CCAGACAGGACGCTTAGAACAGG - Intergenic
1132767650 16:1542511-1542533 CCAGCTAAGAGGCCTAGAACAGG + Intronic
1134790464 16:16984877-16984899 CTAGCCAGGAAGCTTAGAAGGGG - Intergenic
1138581676 16:57945684-57945706 CCTGCCAGTAAGCGTAGAGCTGG - Intronic
1141576569 16:84967722-84967744 CCAGCTAGGAAGGTGAGCACAGG + Intergenic
1144354147 17:14428196-14428218 CCAGCTAGGAACCTTAACACTGG - Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147717202 17:42516450-42516472 TCGGCTGATAAGCTTAGAACAGG - Intronic
1148336286 17:46843634-46843656 CCAGCTAGTAAGCTTAGAACCGG - Intronic
1148949663 17:51299773-51299795 TCAGCTGGTCAGCTTATAACAGG - Intergenic
1151060705 17:71090519-71090541 CCAGGTAATAAGCATAGTACAGG + Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
926857695 2:17274704-17274726 CCAGGTACTATTCTTAGAACCGG + Intergenic
928224773 2:29439133-29439155 CCACCTATCAAGCTTAGAAAAGG + Intronic
928692156 2:33811269-33811291 CAAGCTAGTAAGCATGGAAGAGG - Intergenic
928805811 2:35153047-35153069 ACACCTATTAAACTTAGAACTGG + Intergenic
930773017 2:55146597-55146619 CCAGCTAGCATGCTTCTAACAGG - Intergenic
938964783 2:136378778-136378800 CCATCTAGTAAACTCAGACCCGG - Intergenic
939287019 2:140144933-140144955 CCAGCTAAAAAGCTTAGAGCTGG - Intergenic
941667039 2:168252598-168252620 CCAGCTAGAAAGTGTAGTACAGG - Intergenic
945108910 2:206344278-206344300 CCAGTTAGTAAGCCAAGAGCAGG - Intergenic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
948627854 2:239280069-239280091 CCAGCTCGTCAGCTAAGAACTGG + Intronic
1169826151 20:9770957-9770979 CCAGCAAGAAAGATTAGAAAAGG + Intronic
1170396087 20:15926911-15926933 CCAGCTAGTAGGCTGAGAAGAGG + Intronic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173294139 20:41740647-41740669 CCAGGTAGTGAGCATAGTACCGG + Intergenic
1173598311 20:44274594-44274616 CCAGCAAGTCAACTTAGGACAGG - Intronic
1176000731 20:62830229-62830251 CCAGCCAGGTGGCTTAGAACCGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1179258874 21:39741144-39741166 CCCGTTAGCAAGCTTAGCACTGG + Intergenic
1181885951 22:26022667-26022689 TCAGCTGGTGAGCTTAAAACAGG - Intronic
1184375912 22:44112430-44112452 CCTGCCAGTAAGCTGAGCACAGG - Intronic
1184634850 22:45819038-45819060 TAAGCTAGTAAGCTTACAACTGG - Intronic
949967131 3:9366526-9366548 TCAGCTAGTAATCACAGAACTGG + Intronic
953172419 3:40519349-40519371 CCAGCTACTAAGAGTAGGACAGG - Intergenic
960435204 3:117618261-117618283 CCAGGTAGTAAGCACAGCACAGG - Intergenic
967460350 3:189739061-189739083 CCAGCTAGAAAGCCTTGAGCTGG - Intronic
968003352 3:195222629-195222651 GCAGCTAGCTAGCTGAGAACAGG + Intronic
974733976 4:65904150-65904172 ACAACTAGTAAACATAGAACTGG - Intergenic
975695196 4:77006002-77006024 CCAGCTAGTAGGATCAGAAAGGG + Intronic
976215180 4:82709360-82709382 CCAGCCACTGAGCTCAGAACTGG + Intronic
976391370 4:84508005-84508027 CCAGGTACTGAGCTGAGAACTGG - Intergenic
976693902 4:87898055-87898077 GAAGCTAGTAAGCTAGGAACTGG - Intergenic
980824676 4:138059271-138059293 CCAGCTAATAAGCATTGTACTGG + Intergenic
995880206 5:116836304-116836326 CCAATTAGTAAGCTTTGAATGGG + Intergenic
997710617 5:136001179-136001201 ACAGCAAGTAAGCAGAGAACTGG + Intergenic
1000129491 5:158282280-158282302 ACAGCTAGTAAGTGTAGAAGTGG + Intergenic
1004540072 6:16541378-16541400 CAAGCTGGGAAGCTAAGAACAGG - Intronic
1008899547 6:56595628-56595650 CCAATTAGTCAGCTCAGAACTGG + Intronic
1014860477 6:126460975-126460997 CCAGCCAGTATGTTAAGAACTGG - Intergenic
1015380371 6:132560516-132560538 CCAGGTACTAAGCATAGTACTGG - Intergenic
1016004980 6:139079980-139080002 ACACCTAGGAAGCTGAGAACAGG + Intergenic
1028302977 7:89225429-89225451 CCAGCTATTAACCTTATAAAGGG + Intronic
1034271446 7:149805231-149805253 CCAGCAAGTGAGCTGAGAAGGGG + Intergenic
1034396093 7:150826010-150826032 CCAGCTAGTGTGCTAAGCACTGG + Intronic
1034761100 7:153672680-153672702 CCAGCTAGGAAGTCCAGAACTGG - Intergenic
1036130919 8:6109290-6109312 CCAGACACTAAGCTTGGAACAGG + Intergenic
1040762329 8:50864136-50864158 CCAGGTAGTGAGCATAGTACAGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1043202238 8:77384901-77384923 CCAGGTAGTAAGCTAGGCACAGG + Intergenic
1046542679 8:115606557-115606579 CCAGCCAGAAAGCTAAGAATGGG + Intronic
1048308210 8:133297924-133297946 CCAGTGAGTGTGCTTAGAACTGG - Intronic
1050127494 9:2374097-2374119 CCAGGTACTAAGCCTAGCACTGG - Intergenic
1196499153 X:116358569-116358591 CCAGGTATTATGCTTAGAAATGG + Intergenic
1197921882 X:131603473-131603495 CCATCTATTAAACATAGAACTGG + Intergenic