ID: 1148336666

View in Genome Browser
Species Human (GRCh38)
Location 17:46846684-46846706
Sequence CTGGATAAAGGGCTGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148336660_1148336666 5 Left 1148336660 17:46846656-46846678 CCTGCCTTGGCTGAACTCAAAGA 0: 1
1: 0
2: 1
3: 26
4: 199
Right 1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG 0: 1
1: 0
2: 3
3: 42
4: 390
1148336661_1148336666 1 Left 1148336661 17:46846660-46846682 CCTTGGCTGAACTCAAAGATGCT 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG 0: 1
1: 0
2: 3
3: 42
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148336666 Original CRISPR CTGGATAAAGGGCTGGAGAA TGG Intronic
900581792 1:3413148-3413170 CTGGAGAGAGGGGTGGGGAAGGG - Intronic
901064864 1:6489832-6489854 CCGGCTAAAGGGCAGGAGAATGG + Intronic
901830367 1:11888448-11888470 GTGGAGAAAGGGCTGGTGCAAGG - Intergenic
901907185 1:12423639-12423661 TGGGACAAAGGGCTGGTGAAAGG - Intronic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
903005430 1:20295086-20295108 CTAGATAAAGGGGTGGGGAAAGG + Intronic
904325639 1:29726256-29726278 CTGGATAGCAGGCAGGAGAAAGG + Intergenic
904610673 1:31724586-31724608 GTGGATGAAGGGCTGGAGACTGG + Intergenic
906036302 1:42752223-42752245 GTGGAGAAAGGGGTGGGGAAGGG - Intronic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907914926 1:58860078-58860100 CTGCTTAGAGGGGTGGAGAAGGG + Intergenic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
910801074 1:91146922-91146944 GAAAATAAAGGGCTGGAGAAAGG - Intergenic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911332574 1:96542265-96542287 GAGGAAAAAGGGATGGAGAAGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911686056 1:100779110-100779132 CAGGAGAAAGGGGTGGTGAATGG - Intergenic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
913065287 1:115246954-115246976 CTAGATATAGGGCTAGTGAATGG + Intergenic
914871098 1:151474710-151474732 CTGGTAAAAGGGCTGCAGGAGGG - Intergenic
915511670 1:156390123-156390145 CTGGATGAGGAGCTGCAGAAAGG - Intergenic
915621870 1:157091172-157091194 CTGGATCTAGGCCAGGAGAAAGG - Intergenic
915944125 1:160137314-160137336 CTGGATTTAGGGCTGGGCAAAGG - Intronic
916194882 1:162213319-162213341 CTGGATTAAAGGCTAGACAAAGG - Intronic
916625614 1:166552396-166552418 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916713999 1:167434920-167434942 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714007 1:167434945-167434967 CCGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714021 1:167434982-167435004 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714034 1:167435019-167435041 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714047 1:167435056-167435078 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714073 1:167435130-167435152 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714086 1:167435167-167435189 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714099 1:167435204-167435226 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714112 1:167435241-167435263 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714144 1:167435340-167435362 TTGGAGGAAGGGCTGGAGGAGGG - Intronic
916906616 1:169292588-169292610 CAGGATATAAGGCTGGAGGAGGG + Intronic
917007033 1:170426622-170426644 CTGGAAAAGGGGCTGAAGCAAGG + Intergenic
917457657 1:175199285-175199307 CTGAACAAAGGTGTGGAGAAGGG + Intergenic
917787389 1:178473285-178473307 CTAGGTAAAGGTCTGGAGATAGG - Exonic
917787761 1:178477177-178477199 CTTGAAAAAGGGAAGGAGAATGG - Intronic
918202414 1:182279806-182279828 CTGGATCAGGGGGTGGAGAGTGG - Intergenic
919064252 1:192673247-192673269 TTGGAACAAGAGCTGGAGAAGGG + Intergenic
920171899 1:204077128-204077150 CTGCATAAAGACCTGGAGACAGG + Intronic
920458616 1:206119142-206119164 CTGGTTAAAAGGCAGGACAAAGG - Intergenic
920574779 1:207051269-207051291 CTGAATGAAGGTCTGGAGATTGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
921908231 1:220518267-220518289 CTTGATCATGGGCTGCAGAATGG - Intergenic
922064920 1:222127226-222127248 CAGGATAATGGGCTAGAGAGTGG - Intergenic
922417472 1:225434691-225434713 CTGGATAACTTGCTGGATAAGGG - Intergenic
922793348 1:228323062-228323084 AGGGATAAAGGGCTGGAAACAGG - Intronic
923322712 1:232851444-232851466 ATGGATAGAGGGCTGGGGAGAGG + Intergenic
923329073 1:232906002-232906024 CTGGATCAAGGGCCGCAGAGAGG + Intergenic
923436155 1:233969892-233969914 CAGGAGAAATGGCTGGGGAACGG + Intronic
924367181 1:243307285-243307307 CTAAAGAAAGGGCTGGGGAATGG - Intronic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
1063828031 10:9920765-9920787 ATTGATGAAGGGCAGGAGAAAGG - Intergenic
1063913693 10:10858645-10858667 CTGGATAATGGACTGCAAAAGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064115860 10:12576977-12576999 CTGGGGAAAGGGGTGGAGAGAGG + Intronic
1064753425 10:18554605-18554627 GTGGAAAAAGGACTGGAGAATGG + Intronic
1064754264 10:18560307-18560329 ATGGATAATGGAATGGAGAATGG + Intronic
1064755367 10:18568151-18568173 ATGGATAATGGAATGGAGAATGG - Intronic
1066045753 10:31594375-31594397 CTGGATCGAGGGTTGGAAAAAGG + Intergenic
1066192663 10:33070110-33070132 CTGGCTACAGGGCTGAAGTAGGG + Intergenic
1066517522 10:36179683-36179705 ATGGATAGAGGGATGGATAATGG + Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067569609 10:47361716-47361738 CTGGATGCAGGCCTCGAGAAAGG - Intergenic
1068100140 10:52542393-52542415 CTGGATAAAGATTTGGGGAATGG + Intergenic
1068206830 10:53865163-53865185 ATGGATATAGGTCTGGAGAAAGG + Intronic
1068810268 10:61247855-61247877 TTGGATAAATGGGTGGAGGATGG - Intergenic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1069633384 10:69911108-69911130 ATGGCTAGAGGGCTGGGGAAGGG + Intronic
1070380454 10:75876355-75876377 AGGGAGAAAAGGCTGGAGAAGGG + Intronic
1071396888 10:85232965-85232987 TTGGATAAAGGGCACTAGAAAGG - Intergenic
1073969817 10:109034656-109034678 GTGAATCAAGGGCTGGGGAAAGG - Intergenic
1074407960 10:113196511-113196533 CTGGGTAAAGGGTAGGATAAAGG - Intergenic
1074773543 10:116749175-116749197 CTGGGCTATGGGCTGGAGAAGGG - Intergenic
1077097329 11:804632-804654 CTGGAAAGAGGGTTGGGGAATGG + Intronic
1077446700 11:2595735-2595757 CTTGATTATGGGCTGCAGAATGG - Intronic
1078059137 11:8032128-8032150 CTGGGGAAAGGCCTGGGGAAAGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1080055685 11:27904229-27904251 CTTGTTTAAAGGCTGGAGAATGG + Intergenic
1081376362 11:42363297-42363319 CTGGAGAATGGGGTAGAGAAGGG + Intergenic
1081626511 11:44659158-44659180 ATGGATAATGGGATGGAGAGAGG + Intergenic
1082607542 11:55260393-55260415 ATGAATAAAGGCCTGGAGTACGG - Intergenic
1083431071 11:62613666-62613688 CTGGATGAGGCGCTGGAGGAGGG + Exonic
1084804010 11:71566298-71566320 ATGGATGATGAGCTGGAGAAGGG - Exonic
1085777276 11:79378295-79378317 CAGGATAAAGAGCCAGAGAAGGG - Intronic
1086703078 11:89922176-89922198 ATGAATAAAGGCCTGGAGTATGG + Intergenic
1086758137 11:90591700-90591722 CTGCATAAATGTCTTGAGAAGGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1088907339 11:114164694-114164716 CTGGTTAGAGGGCTAGGGAATGG - Intronic
1089143826 11:116309840-116309862 ATGGCTAAAGGGATGGAAAAGGG - Intergenic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1091281916 11:134386573-134386595 GTGGAAATAGGGCTGGAGAGAGG - Intronic
1092317872 12:7439070-7439092 CAGGACACAGGGCTGGAGCATGG - Intronic
1094395197 12:29998175-29998197 CTTGAGAAAGGTCTGGAGAAGGG - Intergenic
1094438255 12:30445573-30445595 CTGGATAAAGGGAACGGGAATGG + Intergenic
1098010074 12:66041429-66041451 CCCTATAAAGAGCTGGAGAATGG + Intergenic
1099372746 12:81857730-81857752 CTGGTTAGAGGGATGGAGACTGG + Intergenic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1100908753 12:99333752-99333774 CTAGAAAAGGGGCTGGAGATGGG - Intronic
1102199478 12:111047498-111047520 CTGGGGCTAGGGCTGGAGAATGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102349572 12:112182445-112182467 ATGGCAAAAGGGCTGGAAAATGG + Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1105758802 13:23494416-23494438 CAGCAGACAGGGCTGGAGAAAGG - Intergenic
1106032715 13:26017316-26017338 CTTGTTAAAGAACTGGAGAATGG + Intronic
1106200239 13:27530266-27530288 CTGGAGAAAGGGGTGGGGAGTGG - Intergenic
1107205417 13:37779878-37779900 GTGGGTAGAGGGCTGGAGAAGGG - Intronic
1108159389 13:47622203-47622225 CTGGATATAAGGCTGGGGACAGG - Intergenic
1109653728 13:65363476-65363498 CTGGTTACAGGGCTGAAGCAAGG - Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1110832421 13:80046450-80046472 CTGGTCTAAGTGCTGGAGAAAGG - Intergenic
1113395003 13:109939282-109939304 CTGTTTAAAAGGCTAGAGAAAGG - Intergenic
1113561939 13:111288040-111288062 CTGAAAAAAGGGCAGGAGATAGG - Intronic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116364646 14:44044794-44044816 CTGAATAAAGAGCTGAATAAAGG + Intergenic
1116429472 14:44829260-44829282 CTGGATTAAGGTCTGCTGAAGGG - Intergenic
1116549659 14:46220598-46220620 CTGGATACTGGGCAGGGGAAGGG - Intergenic
1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG + Intergenic
1117633013 14:57713046-57713068 CTGGAAAGAGGGTTGGATAATGG - Intronic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1119067020 14:71538806-71538828 CTTGATAAATGACTGAAGAAAGG + Intronic
1119921807 14:78453549-78453571 CTGGAAAAAGGAATGAAGAAAGG - Intronic
1122184800 14:99983528-99983550 ATGGGAAAAGGACTGGAGAAGGG - Intronic
1123118999 14:105908420-105908442 GGGGAGAAAGGGCTGGAGGAGGG + Intergenic
1124374515 15:29121820-29121842 AGGGATAAAGGACTGGAGGAAGG + Exonic
1126687747 15:51263257-51263279 CTGTATAAAGGGCTGCTGAGTGG + Intronic
1127655034 15:61047575-61047597 CAGGATAAAGGTGTCGAGAATGG + Intronic
1128036042 15:64527657-64527679 CTGGAGAAAGGAATGGAGAGAGG - Intronic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1129107368 15:73319199-73319221 CTGGAGACAGGGGTGGGGAAGGG + Intergenic
1129518388 15:76170747-76170769 CTGAACTAAGGGCTGGAGATGGG + Intronic
1130540728 15:84819106-84819128 TTAGGAAAAGGGCTGGAGAATGG + Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131066032 15:89435627-89435649 CTGGATAAAGGGACGGACAAAGG - Intergenic
1133368325 16:5228622-5228644 AGGGAAAAAGGGATGGAGAAAGG + Intergenic
1133836809 16:9374825-9374847 CTGAATAAATGGGTGAAGAAAGG + Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134138738 16:11698189-11698211 CTGAATAACGAGCTGAAGAAAGG - Exonic
1134226192 16:12392437-12392459 ATGGATGAATGGCTGGAGCAGGG - Intronic
1135851753 16:25970112-25970134 CTGTATAAATGATTGGAGAAGGG - Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136117189 16:28101910-28101932 GTGGATGTCGGGCTGGAGAAAGG + Exonic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136543556 16:30942558-30942580 CTGGAGAATGGGCTGGGCAAGGG + Intronic
1137344071 16:47638044-47638066 GGGGATAAGGGGCTGGGGAATGG - Intronic
1137351717 16:47719105-47719127 CTGGATAAGGTGCTTGAGATGGG - Intergenic
1139209979 16:65067849-65067871 TTGGAGAAAGGGAGGGAGAAAGG + Intronic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1140354802 16:74296701-74296723 GCGGAGAAAGGGCTGGAGAAAGG - Intergenic
1141464418 16:84196685-84196707 CTGGTGAAAGGCCCGGAGAAAGG - Exonic
1142198675 16:88750833-88750855 GTGGATAGTGGGCTGGAGGATGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142751291 17:1989486-1989508 CTGGATCACAGGCTTGAGAAGGG + Intronic
1143106249 17:4531862-4531884 CTGGAAAATGGGCTGGAAACGGG + Intronic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1143590549 17:7884170-7884192 CTGGGTAAAGGCTTGGAGATGGG + Intronic
1144175319 17:12699531-12699553 TGAGATATAGGGCTGGAGAAAGG - Intronic
1145017288 17:19407669-19407691 CTGGATAAAGGATGGGATAAAGG - Intergenic
1146370395 17:32262542-32262564 CAGGATGAAGGGCTGGGGAAGGG - Intergenic
1146613529 17:34331920-34331942 CTGGATAAACTGCTGAAGGATGG - Intergenic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147610802 17:41800971-41800993 CTGGAAAAAGGGCTGGGTCAAGG - Intergenic
1148287744 17:46410703-46410725 CTGGAGCAAAGGCTGGAGCATGG - Intergenic
1148309913 17:46628283-46628305 CTGGAGCAAAGGCTGGAGCATGG - Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1149055483 17:52358346-52358368 GTGGATGAGGGGCTGGACAACGG - Intergenic
1149668306 17:58382023-58382045 CTGGTCAAAGGATTGGAGAAGGG - Intronic
1149719004 17:58824117-58824139 TTAGAGAAAGGGTTGGAGAAAGG + Intronic
1150312112 17:64137224-64137246 CTGAACAAAGGCCTGGGGAAAGG + Intergenic
1150411173 17:64941765-64941787 CAGGATAAAGGGGTGGAGAAAGG - Intergenic
1151957529 17:77387905-77387927 CTGGGAACAGGGCTGGTGAAGGG - Intronic
1152157620 17:78645215-78645237 CTGCATTCAGGGCAGGAGAAGGG - Intergenic
1153059400 18:980071-980093 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1153378060 18:4403917-4403939 TGGGAAAAAGGGCTGCAGAAGGG - Intronic
1154058733 18:11037659-11037681 CTGGAAAGAGGGCTGGAAACAGG - Intronic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1155400882 18:25437816-25437838 CTGTATCCAGGGCTGGAGAATGG - Intergenic
1155561165 18:27078726-27078748 CTGTATAAAGAGCTGAAAAAGGG + Intronic
1155671433 18:28376647-28376669 CTGCATAATGGGCTGGAGGGTGG - Intergenic
1156178301 18:34573532-34573554 CTGGGTAAAGGACTGGATAAAGG + Intronic
1156274991 18:35575844-35575866 CTGGACCAAGTGCTGGAGAGTGG + Intergenic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1157808036 18:50672780-50672802 CTGGATCAAGGGGAGGAGCAAGG + Intronic
1160758990 19:773103-773125 CGGGATAGAGGGATGGAGAAGGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160820140 19:1054080-1054102 CAGGAGACAGCGCTGGAGAACGG + Exonic
1161111422 19:2472908-2472930 CTGGAGCCAGGGCTGGAAAAAGG + Intergenic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162297245 19:9821729-9821751 CAGCATACAGGGCTGGAGAGAGG + Intronic
1163383606 19:16985538-16985560 GTGGATAGATGGGTGGAGAAAGG + Intronic
1163845379 19:19635545-19635567 CTGGGAGACGGGCTGGAGAATGG - Exonic
1167109117 19:47448410-47448432 CTGGAGGAAGGGCTGCAGAGCGG + Intronic
1167269107 19:48498139-48498161 GAGGAGAAAGCGCTGGAGAATGG - Exonic
1167677294 19:50895214-50895236 CTGGAGAAAGTGCTTGGGAATGG + Intergenic
1167994410 19:53390670-53390692 CTCGGTAAAGGACTGGAGTAGGG + Intronic
925022491 2:582715-582737 TTGAAAGAAGGGCTGGAGAATGG - Intergenic
925430621 2:3789282-3789304 CTGGAAATAGGGCAGGAAAAAGG - Intronic
925508267 2:4594712-4594734 AGGGAAAAAGGGCTGGAAAAAGG + Intergenic
926916270 2:17894908-17894930 TTAGAAAATGGGCTGGAGAAAGG + Intronic
926946996 2:18199219-18199241 AAGGACAAAGGCCTGGAGAAAGG + Intronic
927105965 2:19825756-19825778 CTGGAAAAGGAGCTGGATAAGGG + Intergenic
928277014 2:29911363-29911385 CAGGATAAAGGACTGGGAAAGGG + Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929443667 2:41986145-41986167 TTGGATATAGGACTGGGGAAAGG - Intergenic
929555445 2:42922854-42922876 CCAGAGAAGGGGCTGGAGAAGGG - Intergenic
929576540 2:43056090-43056112 CTGCATCATGGGCTGGTGAAGGG + Intergenic
930874874 2:56203912-56203934 CTTCCTAAAGGGCTGGATAACGG + Intronic
932211596 2:69936021-69936043 CTGGAAGAAGGGCTGGAGAAAGG - Intronic
932487621 2:72094075-72094097 CTTGAAAATGGGCTGGATAAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932899485 2:75681608-75681630 CTGGAAAAGGGGCTGAAGACAGG + Intronic
933106001 2:78326258-78326280 CTGGATAAAGGACCGGAGAATGG + Intergenic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
935645928 2:105334561-105334583 CTTGACAAAGCCCTGGAGAAAGG - Intergenic
936622418 2:114114167-114114189 CTGGAAATAGGGGTGGAGAAAGG + Intergenic
938676842 2:133644470-133644492 CTGGACAAAGGTTTGGAGATGGG - Intergenic
938748442 2:134304347-134304369 CTGGATACTGGGATGGTGAATGG + Intronic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
940731204 2:157394803-157394825 CTGGATAAAGGTTTGTACAAAGG - Intergenic
942333279 2:174851635-174851657 CTGGAAAATGGGATGGGGAACGG + Intronic
943085021 2:183300780-183300802 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
945018080 2:205541281-205541303 CTGGAAAAAGGGGTGTAGACAGG - Intronic
945427398 2:209723524-209723546 CTGGATAAAGGGAACCAGAATGG - Intronic
945673276 2:212827572-212827594 TTGGATAAAGGCCTGGACACAGG - Intergenic
947329132 2:229009865-229009887 CTGGATAAAATGCTGGAAGAGGG - Intronic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948847003 2:240687955-240687977 CTGGGAAAAGGGTGGGAGAAGGG + Intergenic
1169258637 20:4119153-4119175 ATGGAGAATGGGTTGGAGAAGGG + Intergenic
1169871319 20:10251437-10251459 CTGGATGGAAGGCTGGAAAAGGG + Intronic
1170615252 20:17943505-17943527 CTGGGAACAGGGCTGGAGTATGG + Intronic
1170903801 20:20492530-20492552 CTAGTTAAAAGGCTGGGGAATGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173036184 20:39413363-39413385 ATGGAAAAAGGGGTGGGGAAGGG + Intergenic
1173885170 20:46451139-46451161 CTGGGTCCAGGGCTGGAGAGTGG + Intergenic
1174452873 20:50630673-50630695 CTTGTTAATGGGCTGGGGAAGGG - Intronic
1175119952 20:56709737-56709759 GTGGTTAAAGAGCTGGAGATGGG - Intergenic
1175152659 20:56947237-56947259 CTGGATAATGGGATGGAAATGGG + Intergenic
1175872335 20:62214401-62214423 CTGGACAAAGGCCTGGAGGGGGG - Intergenic
1175940775 20:62536599-62536621 CAGGATACAGGGCTGGAGCCAGG - Intergenic
1178581997 21:33845549-33845571 AAGGTTAGAGGGCTGGAGAAGGG - Intronic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1180214886 21:46317680-46317702 CAGGATGCAGGGCTGGCGAAAGG + Intronic
1181425852 22:22838193-22838215 CTGGATACAGACCTGGAGATAGG + Intronic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1181999251 22:26906789-26906811 ATGGAAGAAGGGATGGAGAAAGG + Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182113190 22:27738861-27738883 CTGGGAGAAGGGCAGGAGAATGG + Intergenic
1183262319 22:36803617-36803639 ATGGATAGAGGGATGGATAAAGG + Intronic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183755022 22:39753987-39754009 GTGGTTGAAGGGGTGGAGAATGG - Intronic
1184370596 22:44079548-44079570 CTGGCTAAAGGGCTGAGTAAGGG - Intronic
1184603868 22:45560688-45560710 CTGGAGAACGGGCATGAGAATGG - Intronic
949129923 3:487484-487506 GTGGCTAAAAGGCTGGGGAATGG + Intergenic
949559023 3:5186116-5186138 CAGGATCAAGGGCTGGAGCTGGG + Intergenic
950615486 3:14154622-14154644 GTGGGTGCAGGGCTGGAGAAGGG + Intronic
951503694 3:23418034-23418056 CTGGAAAAGGGGCTGAAGCAAGG - Intronic
951518496 3:23588709-23588731 GTGGAGAAAGGGGTGGAGCAGGG - Intronic
952557739 3:34552499-34552521 CTGGATAAAGTTCTGAAGATAGG - Intergenic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
954223316 3:49167454-49167476 TTGGAAAAAGGGCAGGAAAAAGG - Intergenic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
954853688 3:53624957-53624979 TTTGATAAAGGGTTGGAGAGGGG + Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957249648 3:77756908-77756930 CTGGAAAAAGGGCTGAAGCCAGG + Intergenic
958486220 3:94713356-94713378 CTAGATTTGGGGCTGGAGAAAGG + Intergenic
961012663 3:123446971-123446993 CTGGATAGAGGGTTGGTGAGGGG - Intronic
962022005 3:131511450-131511472 ATGGAAAGAGGGGTGGAGAAAGG + Intergenic
962844601 3:139263459-139263481 CTGGATTGAGGGCTGGACCATGG - Intronic
962912223 3:139863369-139863391 CTGGGTAATGGGTTGAAGAATGG - Intergenic
963153517 3:142071783-142071805 TGGGATAAAGGGCAGGTGAAGGG + Intronic
965737399 3:171836029-171836051 CCAGATAAAGGGATGGAGAGGGG + Intergenic
966875436 3:184319194-184319216 CTTTGTAAAGGGCTGGAGACAGG + Intronic
967824646 3:193868782-193868804 GTGAATGAAGGGCTTGAGAAAGG - Intergenic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968642715 4:1722341-1722363 CTGGGTACAGGGCAGGGGAAGGG - Intronic
969069763 4:4526397-4526419 CTGGATAGAGGACAGGAAAAGGG + Intronic
969195697 4:5562122-5562144 ATGGATCAAGGCCAGGAGAAAGG + Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969509399 4:7609078-7609100 CTGCATGAGGGGCTGGTGAAGGG + Intronic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
974468499 4:62289048-62289070 CTTTATAAATTGCTGGAGAATGG + Intergenic
975074723 4:70191316-70191338 ATGGAAAAAGGGAAGGAGAAAGG + Intergenic
975212993 4:71722664-71722686 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976438272 4:85043809-85043831 CTGGAAAAGGGGCTGGAGCCAGG + Intergenic
977643768 4:99388026-99388048 CTAAATAGAGGGCTGCAGAAGGG + Intergenic
978303038 4:107292653-107292675 ATGGAGAAAGGAGTGGAGAAAGG + Intergenic
979005093 4:115284325-115284347 CTGGGTAGTGGACTGGAGAAAGG + Intergenic
979190144 4:117846812-117846834 CTAGATCATGGGCTGCAGAATGG - Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
981108224 4:140905621-140905643 CTAGTGAAAGGGGTGGAGAAAGG + Intronic
982304300 4:153913762-153913784 ACGGATGAATGGCTGGAGAAAGG - Intergenic
983897056 4:173092433-173092455 GTGGGAAAAGAGCTGGAGAATGG + Intergenic
984072318 4:175130445-175130467 CTGAAAGAAGGGCTGTAGAAAGG - Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
985474462 5:71612-71634 CAGGACACAGGGCAGGAGAAGGG - Intergenic
985760336 5:1745681-1745703 CTAGATAGTGGGCAGGAGAACGG + Intergenic
985783126 5:1881225-1881247 GAGGAAAAAGGGGTGGAGAAAGG + Intronic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
985986919 5:3523642-3523664 GGGGACAGAGGGCTGGAGAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986311099 5:6551723-6551745 CTGGGCAAAGGCGTGGAGAAGGG - Intergenic
988506266 5:31826150-31826172 ATGGATAAAAGGCAGGAGACAGG - Intronic
989563217 5:42874767-42874789 CTGGACAAAGCTCTGGATAAAGG + Intronic
990914538 5:60889906-60889928 CTGGCTATAGGGTTGGAGTAGGG + Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993609000 5:90031673-90031695 CTGGAAAAGGGGCTGAAGCAAGG + Intergenic
993680543 5:90872760-90872782 CTCTGTAAAGGGGTGGAGAAGGG - Intronic
994438090 5:99763772-99763794 CTGGAAAAAGGGCTGAAGTCAGG - Intergenic
994991333 5:107000234-107000256 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
995817401 5:116186681-116186703 CTGGTTATAGGACTGGAGAGGGG + Intronic
996180634 5:120415183-120415205 CTGGCTAAAGAGCTGCATAAAGG - Intergenic
996426639 5:123320304-123320326 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
996871406 5:128197524-128197546 ATGGAAAAAGGGCCGGTGAAAGG - Intergenic
999290534 5:150422540-150422562 CTGGTTTCAGGGCTGGAGATGGG + Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
1000344141 5:160300317-160300339 CTGCATCAAGGGCTGGATGAGGG - Intronic
1002519052 5:179780512-179780534 CTGGAGGCAGGGCTGCAGAACGG + Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1003997446 6:11556941-11556963 CTGGATCATAGGCTGGAGACTGG - Intronic
1004154817 6:13158243-13158265 CTTGGGGAAGGGCTGGAGAAGGG - Intronic
1005399371 6:25415851-25415873 ATGGAGAAGGGGCTGGGGAATGG + Intronic
1006804198 6:36777876-36777898 AAGAATAAAGGGCTAGAGAAGGG - Intronic
1006912994 6:37576119-37576141 CTGGAGAAGGGGCTGAACAAGGG + Intergenic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008541006 6:52546423-52546445 GTAGAGAAAGGGCTGGAGACGGG + Intronic
1009576813 6:65474397-65474419 TAGGATAAAGGGGTAGAGAAAGG - Intronic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1011681156 6:89784455-89784477 CTAGATAAAGCACTGGGGAAGGG + Intronic
1013420105 6:109959728-109959750 CTGGATAAAGGAGTGCAGGATGG - Intergenic
1013672603 6:112421545-112421567 CTGGAAAGAGGGCTGAAGTAAGG + Intergenic
1014517836 6:122400606-122400628 CAAGATAAAGGGCTGGACTAAGG - Intronic
1015506649 6:133995311-133995333 CTGGAGAATGTGCCGGAGAAGGG + Intronic
1015666654 6:135638056-135638078 CTGGATAAGGTGATGGAAAATGG + Intergenic
1015669707 6:135674405-135674427 CTGAAAAGGGGGCTGGAGAAAGG - Intergenic
1016933413 6:149430321-149430343 CTGGAGAAAGCGCTGGAAAAGGG + Intergenic
1017060380 6:150478878-150478900 ATGGATAAAGGGGAGGAGAGTGG + Intergenic
1018513062 6:164547205-164547227 CTCAATAAAGTGCTGGAGATAGG - Intergenic
1019191328 6:170252673-170252695 ATGGAGCAAAGGCTGGAGAAAGG - Intergenic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1020339002 7:7089250-7089272 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1022331308 7:29381907-29381929 CTGGTCAGAGGGCTTGAGAAAGG + Intronic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1023297346 7:38729175-38729197 CTGGGTAAAGATCTGAAGAATGG - Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1023943052 7:44782328-44782350 CTGGTTAACTGGCTGGAGTAGGG + Intergenic
1026421374 7:70240595-70240617 CTGAATAAAGGGCTAGAGATGGG - Intronic
1028509654 7:91610216-91610238 CTAGATCAAATGCTGGAGAAAGG - Intergenic
1031717311 7:125125194-125125216 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1033411252 7:141119701-141119723 ATGGAGGAAAGGCTGGAGAAGGG + Intronic
1033619979 7:143053182-143053204 AAGGATAAAGGGATTGAGAAAGG - Exonic
1034715132 7:153234972-153234994 CTGGATAAAGGGCTGAAGCCAGG - Intergenic
1034871375 7:154687302-154687324 ATGGACAAAGGACTGGATAAAGG - Intronic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1035305468 7:157928794-157928816 AGGGATAGAGGGCAGGAGAAAGG + Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037502172 8:19496837-19496859 CTGGAGAAAGAGCTTGCGAAAGG - Intronic
1037945401 8:22986595-22986617 CTGGATAGAATTCTGGAGAAGGG - Intronic
1038851753 8:31285490-31285512 CTGGCTTAAGGCATGGAGAATGG - Intergenic
1041192996 8:55372335-55372357 CTGGCTAAAGGTCAGGTGAATGG - Intronic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1044792867 8:95865529-95865551 CTGGTTCCAGGGCTGGGGAAAGG + Intergenic
1045064155 8:98430738-98430760 CTGGGTAGAGGCCAGGAGAAAGG + Exonic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1047496786 8:125414370-125414392 CTAGATAAAGAACTGGAGAGTGG + Intergenic
1048032752 8:130648481-130648503 ATGGATAAAGGGGTGAAGAGTGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1049314330 8:141952690-141952712 CTTGATCCAGGGCTGTAGAAGGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050140866 9:2514467-2514489 GGGGATGAAGGGCTGCAGAAGGG - Intergenic
1051034748 9:12730690-12730712 CTCAATAAATGACTGGAGAAAGG + Intergenic
1052389839 9:27866857-27866879 GTGGATCAAGGGATGAAGAAAGG + Intergenic
1052534499 9:29730448-29730470 CTAGGTAAAGGGTTTGAGAAGGG - Intergenic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053043881 9:34897380-34897402 CTGGGGAAGGGGCTAGAGAAGGG + Intergenic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056976622 9:91262591-91262613 GTGTATAAAGTGCTTGAGAATGG - Intronic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1057811060 9:98256803-98256825 CTGAACAAAGGGCAAGAGAAAGG - Intergenic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1060743262 9:126113393-126113415 CTGGACATGGGGCTGGGGAAAGG + Intergenic
1060966153 9:127713331-127713353 CTGTAAAATGGGCTGAAGAAAGG + Intronic
1061379396 9:130244926-130244948 CTTGCGACAGGGCTGGAGAAAGG + Intergenic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1061722862 9:132563915-132563937 CTGAAGAAAGGGCAGAAGAAAGG - Intronic
1062354885 9:136157228-136157250 ATGGATTATGGGCTGGAGGAAGG + Intergenic
1186084683 X:5974147-5974169 CTGAATGAAGGGGTGGGGAATGG + Intronic
1186315298 X:8363126-8363148 ATGGATAAAAGGCAGGAGACTGG + Intergenic
1187788411 X:22919909-22919931 CTGGAAAAAGGGATTGGGAAGGG + Intergenic
1188073601 X:25748317-25748339 CTGGAGAAAGGACTGGATAGAGG - Intergenic
1189254326 X:39626050-39626072 CTGGGGAGGGGGCTGGAGAAAGG - Intergenic
1189740296 X:44110875-44110897 CTGGCTAGAGGCCTGGAGAAAGG - Intergenic
1191168552 X:57418205-57418227 CTGGAAAAAGGGCTGAAGCCAGG - Intronic
1192188738 X:68977886-68977908 CTTGATAATGAGCTTGAGAAAGG + Intergenic
1192554909 X:72081596-72081618 GTGGAGAATGGGCTGGAGAGTGG - Intergenic
1193068573 X:77282992-77283014 CTGGAAAAAGGGCTGAAGCCAGG + Intergenic
1194283750 X:91984733-91984755 CTGGATGGGGGGCGGGAGAAAGG - Intronic
1195735001 X:108003081-108003103 CAAGGTAAAGGGTTGGAGAAAGG + Intergenic
1196287392 X:113898333-113898355 CAGGAAAAAGGCCTGGAAAAGGG + Intergenic
1196476465 X:116092167-116092189 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1197125343 X:122939359-122939381 CTGATTCAAGGGCTGGAGCAGGG + Intergenic
1197863997 X:130998870-130998892 GTGGATAATGGGCTGCAGAGGGG - Intergenic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198420329 X:136465308-136465330 CTGGACAGGGTGCTGGAGAAGGG - Intergenic
1199420893 X:147643635-147643657 TTGGAAAATGGGCTGGAAAATGG + Intergenic
1200601322 Y:5209297-5209319 CTGGATGGGGGGCGGGAGAAGGG - Intronic