ID: 1148337708

View in Genome Browser
Species Human (GRCh38)
Location 17:46852245-46852267
Sequence GAGGTTTCCCCCATTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337708_1148337716 25 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337716 17:46852293-46852315 CGCAGGAAGGAACCGTGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1148337708_1148337717 26 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337717 17:46852294-46852316 GCAGGAAGGAACCGTGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 111
1148337708_1148337713 8 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337713 17:46852276-46852298 AGAGCGCCAGCTGGAGACGCAGG 0: 1
1: 0
2: 0
3: 11
4: 208
1148337708_1148337714 12 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337714 17:46852280-46852302 CGCCAGCTGGAGACGCAGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 256
1148337708_1148337712 -1 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337712 17:46852267-46852289 CGGACGGTGAGAGCGCCAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 49
1148337708_1148337718 27 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337708 Original CRISPR GAGGTTTCCCCCATTCTCCC TGG (reversed) Intronic