ID: 1148337711

View in Genome Browser
Species Human (GRCh38)
Location 17:46852264-46852286
Sequence GCTGGCGCTCTCACCGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337711_1148337716 6 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337716 17:46852293-46852315 CGCAGGAAGGAACCGTGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1148337711_1148337718 8 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1148337711_1148337714 -7 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337714 17:46852280-46852302 CGCCAGCTGGAGACGCAGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 256
1148337711_1148337717 7 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337717 17:46852294-46852316 GCAGGAAGGAACCGTGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337711 Original CRISPR GCTGGCGCTCTCACCGTCCG AGG (reversed) Intronic