ID: 1148337715

View in Genome Browser
Species Human (GRCh38)
Location 17:46852282-46852304
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337715_1148337721 20 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337721 17:46852325-46852347 ACCACATCTCAGACCTGGCATGG 0: 1
1: 0
2: 3
3: 15
4: 256
1148337715_1148337724 22 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337724 17:46852327-46852349 CACATCTCAGACCTGGCATGGGG 0: 1
1: 0
2: 1
3: 14
4: 214
1148337715_1148337723 21 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337723 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 19
4: 174
1148337715_1148337718 -10 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1148337715_1148337720 15 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337720 17:46852320-46852342 ATGCGACCACATCTCAGACCTGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337715 Original CRISPR TTCCTTCCTGCGTCTCCAGC TGG (reversed) Intronic