ID: 1148337716

View in Genome Browser
Species Human (GRCh38)
Location 17:46852293-46852315
Sequence CGCAGGAAGGAACCGTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337708_1148337716 25 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337716 17:46852293-46852315 CGCAGGAAGGAACCGTGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1148337711_1148337716 6 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337716 17:46852293-46852315 CGCAGGAAGGAACCGTGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337716 Original CRISPR CGCAGGAAGGAACCGTGCGC TGG Intronic