ID: 1148337717

View in Genome Browser
Species Human (GRCh38)
Location 17:46852294-46852316
Sequence GCAGGAAGGAACCGTGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337711_1148337717 7 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337717 17:46852294-46852316 GCAGGAAGGAACCGTGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 111
1148337708_1148337717 26 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337717 17:46852294-46852316 GCAGGAAGGAACCGTGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337717 Original CRISPR GCAGGAAGGAACCGTGCGCT GGG Intronic