ID: 1148337718

View in Genome Browser
Species Human (GRCh38)
Location 17:46852295-46852317
Sequence CAGGAAGGAACCGTGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337708_1148337718 27 Left 1148337708 17:46852245-46852267 CCAGGGAGAATGGGGGAAACCTC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1148337715_1148337718 -10 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1148337711_1148337718 8 Left 1148337711 17:46852264-46852286 CCTCGGACGGTGAGAGCGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148337718 17:46852295-46852317 CAGGAAGGAACCGTGCGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337718 Original CRISPR CAGGAAGGAACCGTGCGCTG GGG Intronic