ID: 1148337719

View in Genome Browser
Species Human (GRCh38)
Location 17:46852305-46852327
Sequence GGTCGCATTTCCCCAGCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337719_1148337724 -1 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337724 17:46852327-46852349 CACATCTCAGACCTGGCATGGGG 0: 1
1: 0
2: 1
3: 14
4: 214
1148337719_1148337726 11 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337726 17:46852339-46852361 CTGGCATGGGGTGATTTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 148
1148337719_1148337723 -2 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337723 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 19
4: 174
1148337719_1148337721 -3 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337721 17:46852325-46852347 ACCACATCTCAGACCTGGCATGG 0: 1
1: 0
2: 3
3: 15
4: 256
1148337719_1148337720 -8 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337720 17:46852320-46852342 ATGCGACCACATCTCAGACCTGG 0: 1
1: 0
2: 0
3: 5
4: 60
1148337719_1148337727 21 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337727 17:46852349-46852371 GTGATTTCTCAGGAGAACACTGG 0: 1
1: 0
2: 1
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337719 Original CRISPR GGTCGCATTTCCCCAGCGCA CGG (reversed) Intronic