ID: 1148337721 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:46852325-46852347 |
Sequence | ACCACATCTCAGACCTGGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 275 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 15, 4: 256} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148337719_1148337721 | -3 | Left | 1148337719 | 17:46852305-46852327 | CCGTGCGCTGGGGAAATGCGACC | 0: 1 1: 0 2: 0 3: 3 4: 62 |
||
Right | 1148337721 | 17:46852325-46852347 | ACCACATCTCAGACCTGGCATGG | 0: 1 1: 0 2: 3 3: 15 4: 256 |
||||
1148337715_1148337721 | 20 | Left | 1148337715 | 17:46852282-46852304 | CCAGCTGGAGACGCAGGAAGGAA | 0: 1 1: 0 2: 1 3: 29 4: 249 |
||
Right | 1148337721 | 17:46852325-46852347 | ACCACATCTCAGACCTGGCATGG | 0: 1 1: 0 2: 3 3: 15 4: 256 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148337721 | Original CRISPR | ACCACATCTCAGACCTGGCA TGG | Intronic | ||