ID: 1148337722

View in Genome Browser
Species Human (GRCh38)
Location 17:46852326-46852348
Sequence CCCATGCCAGGTCTGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337722_1148337726 -10 Left 1148337722 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1148337726 17:46852339-46852361 CTGGCATGGGGTGATTTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 148
1148337722_1148337728 13 Left 1148337722 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1148337728 17:46852362-46852384 AGAACACTGGAAAGAGTGAGAGG 0: 1
1: 0
2: 3
3: 54
4: 414
1148337722_1148337727 0 Left 1148337722 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1148337727 17:46852349-46852371 GTGATTTCTCAGGAGAACACTGG 0: 1
1: 0
2: 1
3: 18
4: 224
1148337722_1148337729 14 Left 1148337722 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1148337729 17:46852363-46852385 GAACACTGGAAAGAGTGAGAGGG 0: 1
1: 1
2: 3
3: 45
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337722 Original CRISPR CCCATGCCAGGTCTGAGATG TGG (reversed) Intronic