ID: 1148337723

View in Genome Browser
Species Human (GRCh38)
Location 17:46852326-46852348
Sequence CCACATCTCAGACCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337715_1148337723 21 Left 1148337715 17:46852282-46852304 CCAGCTGGAGACGCAGGAAGGAA 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1148337723 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 19
4: 174
1148337719_1148337723 -2 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337723 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337723 Original CRISPR CCACATCTCAGACCTGGCAT GGG Intronic