ID: 1148337726

View in Genome Browser
Species Human (GRCh38)
Location 17:46852339-46852361
Sequence CTGGCATGGGGTGATTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148337722_1148337726 -10 Left 1148337722 17:46852326-46852348 CCACATCTCAGACCTGGCATGGG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1148337726 17:46852339-46852361 CTGGCATGGGGTGATTTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 148
1148337719_1148337726 11 Left 1148337719 17:46852305-46852327 CCGTGCGCTGGGGAAATGCGACC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1148337726 17:46852339-46852361 CTGGCATGGGGTGATTTCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148337726 Original CRISPR CTGGCATGGGGTGATTTCTC AGG Intronic