ID: 1148337726 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:46852339-46852361 |
| Sequence | CTGGCATGGGGTGATTTCTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 164 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 148} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148337722_1148337726 | -10 | Left | 1148337722 | 17:46852326-46852348 | CCACATCTCAGACCTGGCATGGG | 0: 1 1: 0 2: 1 3: 16 4: 233 |
||
| Right | 1148337726 | 17:46852339-46852361 | CTGGCATGGGGTGATTTCTCAGG | 0: 1 1: 0 2: 0 3: 15 4: 148 |
||||
| 1148337719_1148337726 | 11 | Left | 1148337719 | 17:46852305-46852327 | CCGTGCGCTGGGGAAATGCGACC | 0: 1 1: 0 2: 0 3: 3 4: 62 |
||
| Right | 1148337726 | 17:46852339-46852361 | CTGGCATGGGGTGATTTCTCAGG | 0: 1 1: 0 2: 0 3: 15 4: 148 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148337726 | Original CRISPR | CTGGCATGGGGTGATTTCTC AGG | Intronic | ||