ID: 1148339498

View in Genome Browser
Species Human (GRCh38)
Location 17:46864873-46864895
Sequence GCTCCTGGAAGGTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 400}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148339498_1148339508 16 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339508 17:46864912-46864934 CTGGGCCGGGTGACCTTAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 69
1148339498_1148339507 15 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339507 17:46864911-46864933 TCTGGGCCGGGTGACCTTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148339498_1148339502 -3 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339502 17:46864893-46864915 AGCCAGCAGAGCAGAACTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 239
1148339498_1148339505 2 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339505 17:46864898-46864920 GCAGAGCAGAACTTCTGGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 233
1148339498_1148339503 -2 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339503 17:46864894-46864916 GCCAGCAGAGCAGAACTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 206
1148339498_1148339506 3 Left 1148339498 17:46864873-46864895 CCTCCAGGACACCTTCCAGGAGC 0: 1
1: 0
2: 5
3: 40
4: 400
Right 1148339506 17:46864899-46864921 CAGAGCAGAACTTCTGGGCCGGG 0: 1
1: 0
2: 4
3: 34
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148339498 Original CRISPR GCTCCTGGAAGGTGTCCTGG AGG (reversed) Intronic
900179777 1:1306011-1306033 GCTCCCTGAGGCTGTCCTGGGGG - Intronic
900799860 1:4730629-4730651 GCTTCTGAAAGGTGGCCTGGGGG - Intronic
900971314 1:5993635-5993657 CCTCCTGGCATTTGTCCTGGGGG + Intronic
901203174 1:7478137-7478159 GCTGCTGGAAAGGGTCCTGGTGG - Intronic
901638583 1:10681785-10681807 GCTCCAGGAACCTTTCCTGGAGG + Intronic
902555558 1:17244620-17244642 GCACCTGGAACGGGGCCTGGGGG + Exonic
902718361 1:18288275-18288297 GATCATGGAAGGCTTCCTGGAGG - Intronic
903243289 1:21998454-21998476 GCATCTGGATGGTGTCCTGATGG - Intronic
903684109 1:25118769-25118791 GCTCGTGGGAGGCCTCCTGGAGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
904455551 1:30645912-30645934 CATCCTGGAAGGCTTCCTGGAGG + Intergenic
904730851 1:32590017-32590039 GCTTCTGCAAGGTGCCCTGAAGG + Intronic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
905541361 1:38763038-38763060 TTTCCTGGAACATGTCCTGGGGG - Intergenic
906104139 1:43281779-43281801 GCTCATGGAAGGTGTCTTGGAGG + Intergenic
906120283 1:43385273-43385295 TCTCCCTGAAGGTGTCCAGGAGG + Intronic
907053851 1:51346744-51346766 GATCCTGGATGGCTTCCTGGAGG - Intergenic
907319277 1:53592641-53592663 GATGCTGGAAGGAGGCCTGGTGG - Intronic
907452161 1:54552369-54552391 GGTCCTAGAAGGCTTCCTGGAGG + Intronic
908945088 1:69486126-69486148 GGACCTGGTAGGTCTCCTGGAGG - Intergenic
912176868 1:107169708-107169730 GCTAGTGCAAGGCGTCCTGGGGG - Intronic
912491745 1:110066266-110066288 GCTCCTGGTGTGTGTCCTGGAGG + Intronic
912933989 1:113986929-113986951 TCGTCTGGAAGGTGTCGTGGAGG - Intergenic
915163424 1:153934883-153934905 GCTCCGGAATGTTGTCCTGGGGG - Exonic
916033042 1:160895054-160895076 GCTCCTGGAAAATGGACTGGAGG - Intergenic
916655925 1:166875738-166875760 GCCCCTGGAGGGCTTCCTGGAGG - Intronic
918404319 1:184196343-184196365 GTTCCAGGAAGGCTTCCTGGAGG + Intergenic
919327773 1:196130958-196130980 GCTCATGGCAGGTTTTCTGGAGG - Intergenic
919900692 1:202042354-202042376 GCTCGGTGAAGGTTTCCTGGAGG - Intergenic
921171993 1:212558606-212558628 GGTTCTGGAAGGTTCCCTGGCGG - Intergenic
1062788452 10:284993-285015 GCACCTGGAGGGTGTCCTCACGG - Intronic
1063486563 10:6425916-6425938 TCTCCTGGTAGGGGTCCTGTTGG + Intergenic
1063705918 10:8430691-8430713 GCTGCTGGGAGGAGACCTGGGGG + Intergenic
1064099583 10:12451831-12451853 GCTTCTGGAAGATTCCCTGGGGG + Intronic
1067234345 10:44435709-44435731 GCTAAGGGAAGGTGCCCTGGAGG - Intergenic
1067292847 10:44957037-44957059 GATGGGGGAAGGTGTCCTGGGGG - Intergenic
1067541072 10:47153548-47153570 GACCCTGGAAGGCTTCCTGGAGG - Intergenic
1067944879 10:50683177-50683199 GCTCCTGGAAACTGTCCTGTTGG - Intergenic
1069350628 10:67521892-67521914 GCTTCTGGTAGGTTTTCTGGAGG + Exonic
1070866380 10:79710048-79710070 GCTCCTGGAAACTGTCCTGTTGG - Intronic
1070880173 10:79848179-79848201 GCTCCTGGAAACTGTCCTGTTGG - Intronic
1071497900 10:86181116-86181138 GCTCCTGGCACCTGTACTGGGGG - Intronic
1071633289 10:87232269-87232291 GCTCCTGGAAACTGTCCTGTTGG - Intronic
1071646738 10:87364487-87364509 GCTCCTGGAAACTGTCCTGTTGG - Intronic
1072611098 10:97018245-97018267 GCTCCTGCCAGGTGCCATGGGGG - Intronic
1072955434 10:99884071-99884093 ACTTTTGGAAGGTGACCTGGTGG - Exonic
1074014075 10:109515425-109515447 GCTCATGGAAAGTCTCATGGAGG - Intergenic
1074268978 10:111934108-111934130 GCTTATGCTAGGTGTCCTGGTGG - Intergenic
1074716084 10:116220567-116220589 ACTCCTGGGAGCTGTCCTGATGG - Intronic
1074880724 10:117655591-117655613 GCTCAGGGAAGGTTCCCTGGAGG + Intergenic
1074961464 10:118449626-118449648 GGTCCTGGAAGGTGGAGTGGAGG - Intergenic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1076607841 10:131700983-131701005 GCTCCTGGAAGGTGTGGGGGCGG - Intergenic
1076707111 10:132308035-132308057 GCTCCTGGAAGGGGTCGAGGCGG + Intronic
1076725195 10:132409831-132409853 GATCCGGGAAGGCTTCCTGGAGG + Intronic
1076904686 10:133356080-133356102 GCCCCTGCCAGCTGTCCTGGGGG + Intronic
1077250869 11:1560126-1560148 TGTTCTGGAAGGTGTCCTCGGGG - Intronic
1078728845 11:13957607-13957629 GCTGCAGGAAAGTGACCTGGAGG + Intergenic
1079193834 11:18306267-18306289 TTTCCTGGAAGATGTTCTGGGGG - Exonic
1082884613 11:58069073-58069095 GCTGCTTGAAGGTTACCTGGGGG + Intronic
1083268707 11:61559674-61559696 GCTCCAGGAAGGTGACCTTTTGG - Intronic
1083652650 11:64212110-64212132 GCTCTGGGAAGGCTTCCTGGAGG + Intronic
1083902207 11:65649166-65649188 GCTCCTGGAAGTGAGCCTGGCGG + Intronic
1084208443 11:67609536-67609558 GCTGCTGGAAGGCTGCCTGGTGG + Exonic
1084681421 11:70668683-70668705 GCACCTGGAAGACTTCCTGGAGG + Intronic
1084815072 11:71640848-71640870 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1085321435 11:75576468-75576490 GGGCCTGGAAGGTTCCCTGGGGG - Intergenic
1085416408 11:76321776-76321798 GCTCAGGGAAGGCGTCCTGGAGG - Intergenic
1085477850 11:76799049-76799071 GCTTGTGGAAGGAGTCCTTGCGG + Intergenic
1085830189 11:79891999-79892021 GTTCGGGGAAGGTTTCCTGGAGG - Intergenic
1086349872 11:85934814-85934836 GATCCTGGCAGGCGGCCTGGCGG + Intergenic
1088089496 11:106021861-106021883 GCTGCTGGTAGGAGTCCCGGTGG + Exonic
1088871973 11:113898202-113898224 GCTGGTGGGAGGGGTCCTGGTGG + Intergenic
1089209412 11:116790343-116790365 TCTGCAGGTAGGTGTCCTGGCGG + Exonic
1090770067 11:129912135-129912157 GCACCTGGATGGCGTGCTGGGGG + Exonic
1090865725 11:130698893-130698915 GGTCCAGGAAGGCCTCCTGGAGG + Intronic
1090871955 11:130756977-130756999 GCTCCTGGAGGAGGTTCTGGAGG + Intergenic
1091593805 12:1861350-1861372 TGTCCTGGAAGATGTCTTGGGGG + Intronic
1092061370 12:5553660-5553682 GCTCCTAGTAGGTGGCATGGTGG + Intronic
1092152790 12:6262545-6262567 GCTCCCGCTGGGTGTCCTGGGGG - Intergenic
1093426614 12:19035122-19035144 GCTCCTGGAAAGTGTCCAGTGGG - Intergenic
1093706115 12:22276496-22276518 GCTCCTGGAGGGCTGCCTGGGGG + Intronic
1094574256 12:31669599-31669621 GAACCTGGTAGGTATCCTGGAGG + Exonic
1095939549 12:47717136-47717158 GCTTCTTGAAGGTGCCCAGGAGG - Intronic
1096001998 12:48137825-48137847 CCTCATGGAATGTGTCCAGGTGG + Exonic
1096553847 12:52391256-52391278 GTCCCTGGTGGGTGTCCTGGAGG + Intergenic
1096707730 12:53433055-53433077 GTTCCTGTACGCTGTCCTGGGGG + Intergenic
1097866127 12:64560516-64560538 GATTCAGGAAGATGTCCTGGTGG - Intergenic
1102245542 12:111353517-111353539 GGTCCAGGAAGGCTTCCTGGAGG + Intergenic
1102535272 12:113576327-113576349 CATCCTGGAAGGCCTCCTGGGGG + Intergenic
1102674034 12:114644272-114644294 TCTCTTGGAATGTATCCTGGGGG + Intergenic
1103338366 12:120207381-120207403 GATCCTGAAAGGTGTTCTGTTGG + Intergenic
1104623449 12:130335329-130335351 GATCCCAGAAGGGGTCCTGGTGG + Intergenic
1104899567 12:132181678-132181700 GCTGCTGGAGGGTGTGGTGGAGG + Intergenic
1105532602 13:21233270-21233292 GCTCCTGGACAGGGTCTTGGGGG - Intergenic
1105831498 13:24166345-24166367 GATCCAGGAAGGCTTCCTGGAGG + Intronic
1105849765 13:24323329-24323351 GCTGCCGGTAGGTGTCCTAGGGG + Intergenic
1106080651 13:26497750-26497772 CATCCTGCAGGGTGTCCTGGGGG - Intergenic
1106467124 13:30023351-30023373 GCTCCAGGAAGGAGTCCTCTGGG - Intergenic
1106735601 13:32585803-32585825 CCTCCTGGAATGTGTCCCTGTGG + Intergenic
1106924538 13:34600318-34600340 GCTTCTGGGAGGTCTCATGGAGG - Intergenic
1107818683 13:44266983-44267005 GCTCCTGGAAGGTGAGCCTGAGG + Intergenic
1110836723 13:80092265-80092287 GCTCTTGCAAGGCGCCCTGGTGG + Intergenic
1113094398 13:106648508-106648530 ACTCCTAGAATGTGACCTGGAGG + Intergenic
1113536010 13:111066849-111066871 GCTCGTGGAAGGGGTGCAGGGGG - Intergenic
1113671593 13:112179196-112179218 GCTCCTGAAAGGTCTGCTCGTGG + Intergenic
1113867538 13:113537060-113537082 GCACCTGGGTGTTGTCCTGGCGG + Intronic
1118603578 14:67487286-67487308 GTTCCGGGAAGGGGCCCTGGTGG - Intronic
1118880059 14:69818160-69818182 GCCTATGGAAGGTGTCCTGAGGG - Intergenic
1119419978 14:74502758-74502780 GCTCAGGGACGGTGTCCTCGGGG + Exonic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1121528865 14:94638710-94638732 GTTCCTGGAAGGTTTCCTGGAGG - Intergenic
1121634501 14:95444754-95444776 GCTCAGGGAAGGCTTCCTGGAGG - Intronic
1122266040 14:100547332-100547354 GTTTCTGGAAGGCTTCCTGGAGG - Intronic
1122342110 14:101035176-101035198 GCTCCAGGAAGCCCTCCTGGGGG - Intergenic
1122366462 14:101197610-101197632 GCTCCAGGAGGGCTTCCTGGAGG + Intergenic
1122407209 14:101507693-101507715 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
1122721223 14:103723714-103723736 GCTTCTGGAAGGAGTCCTATGGG - Intronic
1123476514 15:20595306-20595328 GCTCCTGGGAGGTGTTCACGTGG + Intergenic
1123641497 15:22405058-22405080 GCTCCTGGGAGGTGTTCACGTGG - Intergenic
1124439780 15:29677647-29677669 GCCCCTGGCAGCAGTCCTGGAGG + Intergenic
1125422787 15:39521340-39521362 GCTCCTGGACCGCTTCCTGGAGG + Intergenic
1126115242 15:45201977-45201999 GCTCCTCTCAGGTGTCCTGAGGG + Intergenic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1127567692 15:60208899-60208921 GCTCCTGGAAAGTGTCCAAAAGG - Intergenic
1128155576 15:65389628-65389650 AATCCAGGAAGGTTTCCTGGAGG - Intronic
1128702497 15:69814434-69814456 GATCCTGGAAGGTTTCTTGCAGG - Intergenic
1129127706 15:73458760-73458782 GCTCTAGGAAAGTGTCATGGTGG - Intronic
1129254751 15:74327781-74327803 GCTCATGGAGTGAGTCCTGGGGG - Intronic
1129356465 15:74995402-74995424 GCTCCTGGAAGATGCCGGGGCGG + Intronic
1129375236 15:75126188-75126210 GGTCCTTGCAGGTTTCCTGGGGG - Intergenic
1129386091 15:75196800-75196822 GCTCAGGGAAGGCTTCCTGGAGG + Intronic
1129868276 15:78925200-78925222 GCACCTGGCAGGTGTCATGAAGG + Intronic
1129978675 15:79846350-79846372 CCTCCTGACAGCTGTCCTGGGGG + Intronic
1130321339 15:82844966-82844988 GCTCCTGCCAGGTGCCCTGGGGG + Intronic
1130834944 15:87640854-87640876 GCTCCTGGAGGGGATCCTGGAGG - Intergenic
1131175910 15:90209717-90209739 GATCCAGGAAGGCCTCCTGGAGG + Intronic
1131247777 15:90810472-90810494 GCTCCTGTAGGGTGGCCTGTAGG + Intronic
1131416880 15:92267610-92267632 CCTCCTGGGAGGTGAGCTGGAGG - Intergenic
1132552665 16:559914-559936 GCCCCTGGGGGCTGTCCTGGGGG - Intergenic
1132586818 16:709187-709209 GCTCCTGGTAGGGGTTCTGCAGG - Intronic
1132749452 16:1450747-1450769 GCTCCTGGAAGGTGACTGTGAGG - Intronic
1132871027 16:2115826-2115848 GCTCATTCCAGGTGTCCTGGGGG - Intronic
1132876903 16:2144004-2144026 GGTCTTGGGAGGTGCCCTGGGGG + Intronic
1133328151 16:4954866-4954888 GTTCCTGGAAGGCATCCTGCTGG - Intronic
1133810529 16:9157928-9157950 GCACCTGGAAGGTTGCCTTGGGG + Intergenic
1133970555 16:10564738-10564760 CCTCCTGGAGGCTGCCCTGGTGG - Intronic
1134189896 16:12112936-12112958 GCACCTGGAAGGAGGCCTGATGG + Intronic
1134521501 16:14921055-14921077 GCTCATTCCAGGTGTCCTGGGGG + Intronic
1134709172 16:16319706-16319728 GCTCATTCCAGGTGTCCTGGGGG + Intergenic
1134716381 16:16359735-16359757 GCTCATTCCAGGTGTCCTGGGGG + Intergenic
1134833056 16:17338897-17338919 ACTCCTGGAAGGCTTCCTGGAGG - Intronic
1134950433 16:18348939-18348961 GCTCATTCCAGGTGTCCTGGGGG - Intergenic
1134958369 16:18392424-18392446 GCTCATTCCAGGTGTCCTGGGGG - Intergenic
1135540329 16:23324935-23324957 GCTCCTGGCATGGGGCCTGGTGG + Intronic
1136019510 16:27431038-27431060 GATCCTGGAGGGCTTCCTGGAGG + Intronic
1136268374 16:29133790-29133812 GCTCCTGGACTGTGGACTGGGGG + Intergenic
1136453820 16:30369716-30369738 GGTCCTGGTAGGGGTCCCGGTGG + Exonic
1136615238 16:31394411-31394433 ACCCCAGGGAGGTGTCCTGGAGG + Intronic
1137611758 16:49822723-49822745 TCTCCAGGAAGTTTTCCTGGGGG + Exonic
1140156009 16:72427408-72427430 GATCCTGAAAGGTGTTCTGTTGG + Intergenic
1140476022 16:75239622-75239644 GCTCCTGGATTGGGACCTGGGGG - Intronic
1141034279 16:80614323-80614345 GCACCTGGAAGTGGTACTGGTGG - Intronic
1141503502 16:84460484-84460506 GCTTCTGGAAGGTGCCGAGGAGG + Intronic
1141946692 16:87315604-87315626 GGGCCTGGGAGGTGTTCTGGAGG + Intronic
1142071684 16:88094124-88094146 GCTCCTGGACTGTGGACTGGGGG + Intronic
1142378730 16:89720457-89720479 GATTTTGGAAGGTGGCCTGGCGG + Intronic
1142489561 17:269525-269547 GCTGTTAGAAGGTGTTCTGGAGG + Intronic
1143296845 17:5877568-5877590 GATCCTGGAAGGCTTCCTGGAGG - Intronic
1143609089 17:8007317-8007339 GCTCAGGGGAGGGGTCCTGGAGG - Intronic
1144055893 17:11540234-11540256 GCTCCTGGATGCTGACCTGTGGG + Intronic
1144628360 17:16857038-16857060 GCTCCAGGAAAGCATCCTGGTGG - Intergenic
1144654936 17:17029378-17029400 GCTCCAGGAAAGCGTCCTGGTGG + Intergenic
1145159952 17:20567608-20567630 GCTCCAGGAAATCGTCCTGGTGG - Intergenic
1148088002 17:45006303-45006325 GTTCCTGGGAGGGGTCTTGGGGG + Intergenic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148497393 17:48061118-48061140 GCTCCTGGAGGGCTGCCTGGGGG + Exonic
1148788444 17:50158585-50158607 AATTCTGGAAGGTCTCCTGGTGG - Intergenic
1149651801 17:58280448-58280470 GCTCTGGGCAGCTGTCCTGGGGG - Exonic
1150331319 17:64296694-64296716 GCTCATGGGAGCTGTCTTGGGGG - Intergenic
1151679127 17:75614629-75614651 GGACCTGGAGGGGGTCCTGGGGG - Intergenic
1151746613 17:76015001-76015023 ACTCCTGGAAGTTGTTCTGCAGG + Exonic
1151898552 17:76996779-76996801 GCTCCTGGAAGGTTCCCTGCTGG + Intergenic
1152046149 17:77937151-77937173 GACCCTGGGAGGTTTCCTGGAGG - Intergenic
1152088090 17:78232297-78232319 GGTCCTGGAAGGGGGTCTGGCGG - Intronic
1152930962 17:83109670-83109692 GCTCATGGACGGTGGCCTGAGGG - Intergenic
1153757897 18:8302079-8302101 GGTCCTGGAAGATTTCGTGGGGG + Intronic
1156012714 18:32513088-32513110 GCTCCTGGAGGTGGTCCAGGGGG - Intergenic
1157411264 18:47465319-47465341 GCTCCTGGAAGGTGGGATGGGGG - Intergenic
1157580438 18:48771121-48771143 GATCAGGGAAGGTTTCCTGGAGG - Intronic
1159184083 18:64947379-64947401 GCTTCAGGAAGGTGTCCTTCAGG + Intergenic
1160548863 18:79680299-79680321 GCTCCGGGGAGGGATCCTGGAGG + Intronic
1160957036 19:1698579-1698601 GCCCCTGGACAGTGTCCTGAAGG - Intergenic
1161028183 19:2046251-2046273 GCTGCAGGAAGATGTGCTGGGGG - Exonic
1161118365 19:2511917-2511939 GGTCCGGGAAGGTGCCCAGGTGG + Exonic
1162003926 19:7765231-7765253 GCTCTTGGCTGGGGTCCTGGTGG + Exonic
1162034689 19:7932592-7932614 CCGCCTGGGAGGGGTCCTGGGGG + Intronic
1162339430 19:10083265-10083287 GCTCTTGGAAGGTGCTCGGGAGG + Intergenic
1162835622 19:13315667-13315689 GTTCCTGAGGGGTGTCCTGGGGG + Intronic
1162957424 19:14107105-14107127 GCTGCTGGCAGCTGTGCTGGGGG + Intronic
1163218538 19:15897927-15897949 GCTCCTGGGTGCTGGCCTGGAGG - Intronic
1163468450 19:17483358-17483380 GTGCCTGGAAGGTTTCCTGAGGG + Intronic
1163627403 19:18398024-18398046 GGTCCTGGAAGGCTTCCTGGAGG + Intergenic
1163691421 19:18740593-18740615 GCTCCTGGGAGGTGACCTGCAGG - Intronic
1163700491 19:18784413-18784435 TCTCCAGGAAGGTGTCTAGGGGG - Intronic
1163715021 19:18868445-18868467 GCCTCTGGCAGGTGGCCTGGAGG + Intergenic
1163776666 19:19222773-19222795 GGTCCTGGAAGGCTTCCTGGAGG - Intronic
1164522469 19:28989697-28989719 GCTCCTGGAGGGTGGCCTCCAGG + Intergenic
1166015126 19:39973961-39973983 GCACATGGGAGGTGTCCAGGAGG + Intronic
1166294171 19:41880914-41880936 CATCCTGGTAGGTGCCCTGGAGG - Exonic
1166745683 19:45140867-45140889 GTTCCTGAAAGGGCTCCTGGGGG - Intronic
1166975278 19:46601910-46601932 GCTCCTGGATGGGGTGGTGGAGG + Intronic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1167688816 19:50972887-50972909 GTTCAGGGAAGGTTTCCTGGAGG - Intergenic
1168070501 19:53947785-53947807 GCTCAGGGAAGGCTTCCTGGTGG - Intergenic
1168103678 19:54154073-54154095 GCTCCAGGAAGGTTTCTTTGAGG - Intronic
1168464182 19:56589048-56589070 GGTTCTGGAATGAGTCCTGGAGG + Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925173618 2:1767477-1767499 GCTCCTGGGAGGTGACCTCTCGG + Intergenic
925180349 2:1813409-1813431 GCTGCTGGAAGCTCTCCTGGGGG - Intronic
925390395 2:3490336-3490358 GGTCCTGGGAGGAGCCCTGGGGG - Intergenic
926020872 2:9494736-9494758 ACTCCTGCAAGGTGTGCTGCAGG - Exonic
926297826 2:11581396-11581418 GCTCAGGGAAGGCTTCCTGGAGG + Intronic
926630858 2:15135210-15135232 GCTTCTTCAAGGTGGCCTGGGGG + Intergenic
927518007 2:23683137-23683159 GGGCCAGGAAGGAGTCCTGGCGG + Intronic
928620633 2:33084399-33084421 GCTGGTGGGAGGCGTCCTGGAGG + Intronic
929688951 2:44058870-44058892 TCTTCTGGAAAGTTTCCTGGAGG + Intergenic
930114602 2:47707852-47707874 GGTCAGGGAAGGTTTCCTGGGGG + Intronic
932593238 2:73079617-73079639 CCTCCTGGACAGTGTTCTGGGGG + Intronic
933941717 2:87250673-87250695 GCTGATGACAGGTGTCCTGGAGG + Intergenic
934196856 2:89844457-89844479 GGCTTTGGAAGGTGTCCTGGAGG - Intergenic
934936656 2:98470474-98470496 GCCCCTGCAAGGAGGCCTGGTGG + Intronic
936338508 2:111610896-111610918 GCTGATGACAGGTGTCCTGGAGG - Intergenic
937280109 2:120711881-120711903 GGTCCAGGAAGGCTTCCTGGAGG + Intergenic
943782857 2:191844482-191844504 GCTCTTTAAAGGTGTCCTTGGGG + Intronic
946053579 2:216883016-216883038 GCTCCAGGGAGGTCTGCTGGTGG + Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948393616 2:237628963-237628985 GAGTCTGGAAGGTCTCCTGGAGG - Intronic
1169012409 20:2261409-2261431 ACTCCAGGAAGGCTTCCTGGGGG + Intergenic
1169067799 20:2704278-2704300 ATTCCTGGAGGGTGTCCTAGGGG + Intronic
1170763634 20:19272947-19272969 GGTCCAGGAAGGCTTCCTGGAGG + Intronic
1171427571 20:25058217-25058239 GCTCCGGGAGGGGGCCCTGGAGG - Intronic
1171469501 20:25358754-25358776 GACCCTGAAAGGTGTTCTGGGGG - Intronic
1171558138 20:26096633-26096655 GGTCCGGGGAGGAGTCCTGGGGG - Intergenic
1172598618 20:36168135-36168157 GCCCCTGGAAGGTGAGCTAGAGG + Intronic
1172944189 20:38674919-38674941 GATCCGGGAAGGCCTCCTGGAGG + Intergenic
1173316601 20:41950412-41950434 CCTCCTGGAAGGTGGGCTGCAGG - Intergenic
1174203446 20:48823203-48823225 GCTCCTCGAAGGTCTCCCCGTGG - Intronic
1174295298 20:49541215-49541237 GCTCCTGCTAGGTTTCCAGGTGG - Intronic
1175914616 20:62419854-62419876 ACTCATGGGAGGTGGCCTGGAGG + Intronic
1175954159 20:62599749-62599771 GTGCCCTGAAGGTGTCCTGGTGG - Intergenic
1176305950 21:5123269-5123291 GCAGCTGGAGGGTGTGCTGGGGG - Intronic
1176378030 21:6096460-6096482 GCACCTGGGAGGTGACTTGGAGG - Intergenic
1178891421 21:36523922-36523944 GCTCCTGGAGTGTGACCTGAGGG + Intronic
1179452850 21:41477553-41477575 GCTCCTGCAAGGTGGTTTGGGGG - Intronic
1179594180 21:42431041-42431063 GCTCCACGCAGCTGTCCTGGTGG + Intronic
1179745443 21:43441786-43441808 GCACCTGGGAGGTGACTTGGAGG + Intergenic
1179851107 21:44138762-44138784 GCAGCTGGAGGGTGTGCTGGGGG + Intronic
1180206812 21:46265858-46265880 GCTCCTGGGAGGCGTTCTGGTGG + Intronic
1180921903 22:19525403-19525425 GCTTCCGGAGGGTGGCCTGGGGG - Intronic
1181037070 22:20174809-20174831 GCTCCTGGCTGGGGTCCAGGTGG + Intergenic
1181162506 22:20966773-20966795 GGCCCTGCAAGGTGCCCTGGGGG - Intronic
1181265499 22:21628687-21628709 GGTCCTGGAAGGTACCCTAGCGG - Exonic
1181514101 22:23401746-23401768 GCTCCTGGAGGCAGGCCTGGGGG + Intergenic
1181637176 22:24179953-24179975 GCTCCAGGGAGGGGTGCTGGGGG - Intergenic
1182017889 22:27056128-27056150 GCTCCTGGTTGGAGTCCTGCAGG + Intergenic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1184285030 22:43465675-43465697 GCTCTTGGAAGGTGTCTTGGAGG + Intronic
1184286746 22:43476322-43476344 GATCCTGGAAGGCTCCCTGGAGG + Intronic
1184438477 22:44494853-44494875 GCACCTGGAAGGTTTCCATGTGG - Exonic
1184511320 22:44934919-44934941 GCTCCTGGAAGGTCTCAGCGAGG - Intronic
1184565394 22:45288847-45288869 GATCCAGGGAGGGGTCCTGGGGG + Intronic
1184566505 22:45295204-45295226 GCTGCAGGAAGGCTTCCTGGAGG - Intronic
1185027805 22:48425486-48425508 GCTCCTGGGAAGTGCCCAGGGGG + Intergenic
1185316287 22:50180620-50180642 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
950900930 3:16496820-16496842 TCTCCTGGAAGGTGTTTGGGCGG - Intronic
953210138 3:40868339-40868361 GCTCCTTGAAGGTCTCCTGTTGG - Intergenic
953381584 3:42476551-42476573 GCTCCTGGAAAGTGCACTCGAGG + Intergenic
953484923 3:43286420-43286442 GCTGCTGGAGGGCATCCTGGCGG - Intergenic
953978298 3:47399217-47399239 GCTCCTGGAACTGGTGCTGGGGG + Intronic
954400802 3:50318524-50318546 GGTACTGGCAGGTCTCCTGGAGG + Exonic
954612913 3:51955706-51955728 GATCCTGGCAGCTGTCGTGGAGG + Exonic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
954755306 3:52835985-52836007 GCTCCTGGCCTGTGCCCTGGGGG - Intronic
954791234 3:53134949-53134971 GCTTCTGGAAGGGGCCCTGATGG - Intergenic
956321840 3:68006704-68006726 GCTGCTGGAAAGTGTGCTGAAGG - Exonic
961104596 3:124230350-124230372 GATCCAGGAAGGTCTCCTGGAGG - Intronic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
962901136 3:139762777-139762799 GCTCTTTGCAGGTTTCCTGGAGG + Intergenic
963643651 3:147886973-147886995 ACTGCTGGAATGTGTCCTGGGGG + Intergenic
966390772 3:179450992-179451014 GTTCCTGGAAGGAGGCCTCGGGG + Intronic
966497891 3:180601728-180601750 GCTCCGGGAAGGTTTCCAGGTGG - Intergenic
968058556 3:195711482-195711504 GCTCCTGGTGAGTCTCCTGGAGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968676735 4:1885813-1885835 GCGCCTGGAACTTGTCCTGAGGG - Intronic
969092236 4:4703301-4703323 GCTCCTGGAGGGTGTGAAGGTGG - Intergenic
969265669 4:6062683-6062705 GCTCCTGGGAGGAGTGCTGATGG - Intronic
969291660 4:6243930-6243952 GCACCTGGGAGGGGTCCTGGAGG - Intergenic
969503902 4:7571566-7571588 GGTCATGGAAGGCTTCCTGGAGG + Intronic
969590908 4:8121473-8121495 GCTCATGGGAGGTGTCCCGGAGG + Intronic
969980864 4:11152705-11152727 GCCTCTGGAAGATGTCTTGGTGG - Intergenic
970671238 4:18398831-18398853 GCTGCTGGCATGTGTCCAGGAGG - Intergenic
972768602 4:42174510-42174532 GCTCCGCAAAGGAGTCCTGGTGG - Intergenic
973644002 4:52931987-52932009 CCACCTGGAAGGCTTCCTGGAGG + Intronic
974016919 4:56656266-56656288 GTTCCTGCAAGGGGTCCCGGGGG - Intronic
980093353 4:128465006-128465028 GCTCCTGGAATGTAATCTGGGGG + Intergenic
980858962 4:138476157-138476179 ACTCCTGGAAGATGTCCATGGGG + Intergenic
983935934 4:173502588-173502610 GGCCCTGGGAGGAGTCCTGGTGG + Intergenic
984844871 4:184100646-184100668 TCTCCTGCAATGTGTGCTGGAGG + Intronic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
992364586 5:76078740-76078762 GCTCCTGGAAAATGGACTGGAGG - Intergenic
997443136 5:133922813-133922835 TCTCCTGAAAGGTGGGCTGGAGG - Intergenic
998250609 5:140549686-140549708 GCTGCTGGAAGTGGGCCTGGTGG - Intronic
998808452 5:145941464-145941486 CCTCCAGGAAGAGGTCCTGGTGG + Intronic
999144982 5:149386465-149386487 GCTCCTGCAGGGAGTCCAGGGGG - Intronic
999357782 5:150953344-150953366 ACTCCTGGAAAGCTTCCTGGGGG + Intergenic
1001415151 5:171540470-171540492 GCTCATGGAAGGGGTCCTTAGGG - Intergenic
1001587678 5:172844549-172844571 GCTCGTGGGAGGTGGCCTGGTGG + Intronic
1002361173 5:178672215-178672237 CCTTCTGGAAGGTGGACTGGTGG + Intergenic
1002462316 5:179380546-179380568 GTTCCTCGAAGGTTTCCTGCTGG - Intergenic
1002925319 6:1602359-1602381 GCCCCGGCATGGTGTCCTGGAGG + Intergenic
1003389665 6:5702851-5702873 GCTCCTGGACAGGGTCTTGGGGG + Intronic
1003390420 6:5708463-5708485 GCCCCAGGCAGGTGTCCTGAAGG + Intronic
1005583627 6:27255240-27255262 GCTGCTGGAAGATGTTCTGTGGG - Exonic
1005806474 6:29478275-29478297 GCTCCTGCTTGGTGCCCTGGTGG - Intergenic
1006169359 6:32084311-32084333 GCTCCGGGAAGGCTTCCTGGAGG - Intronic
1007107749 6:39295304-39295326 GCTTCTGGACGATGTGCTGGTGG + Intergenic
1007278618 6:40693651-40693673 GCTTGTGGAAGGCTTCCTGGAGG - Intergenic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1007335246 6:41150861-41150883 GCTCCTGGTAGGTCTGCTGGTGG - Exonic
1007415361 6:41688339-41688361 GTTTCTGGACGGTTTCCTGGAGG + Intronic
1009969250 6:70609238-70609260 GCTCCTGGAAAATGGACTGGAGG + Intergenic
1013162195 6:107555564-107555586 GCGCTTGGAAGGTGCCCTGCTGG - Intronic
1014486316 6:122003577-122003599 GATCATGGAAGGTTTCATGGAGG + Intergenic
1015629687 6:135219506-135219528 GCACCTGGAAGGCCGCCTGGAGG + Intergenic
1017656601 6:156635195-156635217 CCTCCGCGAAGGTGTCGTGGGGG + Intergenic
1018170430 6:161139605-161139627 CCTCCTGAAAGGCATCCTGGGGG + Exonic
1018899153 6:168042622-168042644 GGCCCTGGCAGGCGTCCTGGGGG + Exonic
1019212282 6:170416468-170416490 GCTCATAGAAGATGACCTGGTGG + Intergenic
1019463957 7:1176234-1176256 TGTCCCGGAAGCTGTCCTGGCGG - Intergenic
1019747670 7:2709633-2709655 GCTCGTGGCACGTGACCTGGGGG - Exonic
1019989694 7:4682752-4682774 GCTCCTGGAAGCTGAGCTGCAGG - Exonic
1021089340 7:16464304-16464326 GCTGCAGGAAGGTGAGCTGGAGG - Intronic
1023826291 7:44012146-44012168 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1025987525 7:66466890-66466912 CCTCCTGGAAGCAGTGCTGGTGG - Intergenic
1026003857 7:66584807-66584829 CCTCCTGGAAGCAGTGCTGGTGG - Intergenic
1026023394 7:66727689-66727711 GCCCCTCGCAGGGGTCCTGGCGG + Intronic
1026027471 7:66758530-66758552 CCTCCTGGAAGCAGTGCTGGTGG + Intronic
1026089868 7:67291011-67291033 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1026671977 7:72398709-72398731 GCTCCTCTTAGGGGTCCTGGGGG + Intronic
1026746586 7:73017850-73017872 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026750238 7:73045993-73046015 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026753885 7:73074103-73074125 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026757536 7:73102139-73102161 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026868800 7:73838504-73838526 GGTCTGGGAAGGTTTCCTGGAGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027032689 7:74902408-74902430 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027089868 7:75291347-75291369 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027093513 7:75319275-75319297 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027097156 7:75347242-75347264 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027119460 7:75506330-75506352 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027272365 7:76529281-76529303 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027322192 7:77020428-77020450 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027325822 7:77048347-77048369 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027374575 7:77537338-77537360 GCTCCTGGAAGTTGTGGTGTCGG + Exonic
1029131628 7:98335775-98335797 GCTGAGGGAAGGTGTCCCGGTGG - Intronic
1029398265 7:100324243-100324265 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1029630502 7:101747451-101747473 GAGCCTGGAAGGCTTCCTGGAGG - Intergenic
1029718036 7:102343702-102343724 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1029754578 7:102565543-102565565 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1029772529 7:102664627-102664649 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1034253846 7:149714095-149714117 GCTGCTGGAAGGGGGCCTGCGGG - Intergenic
1034274082 7:149816499-149816521 GGTGCTGGAAGGTGCCCTCGGGG - Intergenic
1034545560 7:151786496-151786518 GCTCCTGGACGGAGACCTGGAGG - Exonic
1035079808 7:156206477-156206499 GCTCCTGAATGTTGTCCTGCCGG - Intergenic
1035177834 7:157065019-157065041 GCTCAGGGAAGGCTTCCTGGAGG - Intergenic
1036242822 8:7093397-7093419 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036257980 8:7220631-7220653 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036259229 8:7227629-7227651 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036273549 8:7330612-7330634 CCTCATGTAAAGTGTCCTGGGGG - Intergenic
1036307398 8:7611892-7611914 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036310029 8:7679227-7679249 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036311282 8:7686224-7686246 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036347798 8:7979740-7979762 CCTCATGTAAAGTGTCCTGGGGG + Intergenic
1036358241 8:8059876-8059898 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036359506 8:8066875-8066897 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036688039 8:10924700-10924722 TCTCCAGGAAGGTCTCCAGGAGG + Exonic
1036891450 8:12600077-12600099 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036892708 8:12607067-12607089 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1037522429 8:19693014-19693036 ACTCCTGGCAGGTGTGCTGATGG - Intronic
1038330478 8:26604422-26604444 GGGCCTGGAAGGCTTCCTGGAGG + Intronic
1039518673 8:38153270-38153292 GGTCTAGGAAGGTTTCCTGGAGG - Intergenic
1040579779 8:48688358-48688380 GCAGCAGGAGGGTGTCCTGGCGG - Intergenic
1042217399 8:66439650-66439672 GGTCCAGGAAGTTCTCCTGGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046871028 8:119206158-119206180 GCTCATGGTTAGTGTCCTGGAGG + Intronic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1048004983 8:130411876-130411898 GCTCCTGGAAGGTGACTTCCAGG - Intronic
1048799462 8:138182675-138182697 GGTCATGGAAGGCTTCCTGGAGG + Intronic
1049220494 8:141426688-141426710 GGTCCAGGAAGGCTTCCTGGAGG + Intronic
1049257053 8:141619788-141619810 TCTCTTGGGAGGGGTCCTGGAGG - Intergenic
1049320272 8:141992511-141992533 GCACCTGGACGGTGTCCAGCAGG + Intergenic
1049758269 8:144320420-144320442 GGTCCTAGAAGGTTCCCTGGGGG - Intronic
1049786520 8:144453536-144453558 GCTCCAGCCAGGTGTCCTGAGGG + Intronic
1050600030 9:7241379-7241401 GCTGCTGTAATGTGTTCTGGAGG - Intergenic
1051040949 9:12810176-12810198 GAACCTGGTAGGTTTCCTGGAGG + Intronic
1051961488 9:22769587-22769609 GGTCCTGGTAGGGTTCCTGGAGG + Intergenic
1052537201 9:29761977-29761999 GCTCCAGGCTGGTGTACTGGGGG - Intergenic
1053010074 9:34628008-34628030 GCGCCTGGAAGCTGTCATGGAGG - Exonic
1053070004 9:35095658-35095680 TCTCCAGGAAGGTTTCCGGGAGG - Intronic
1055178674 9:73354470-73354492 GCTCCTAGAAGTTGTTGTGGAGG + Intergenic
1056331035 9:85521496-85521518 GCCCCTGGAAGGCGTCCTGGTGG - Intergenic
1056580761 9:87886935-87886957 GCTCCTGGGAGGTGTTCACGTGG - Exonic
1057354078 9:94320962-94320984 ACTCCCGGAAGCTGTCCTGTTGG + Intronic
1058910897 9:109518975-109518997 GCTCCAGGAAGTCTTCCTGGAGG - Intergenic
1059245953 9:112849801-112849823 GCTGCTGGAAGGTCCCCTGTGGG + Intronic
1060361076 9:122958245-122958267 GCTCCTGGAGGGCTGCCTGGGGG - Intronic
1060712749 9:125886068-125886090 GCTCATGTAAGTTGTACTGGAGG + Intronic
1060936991 9:127521716-127521738 GTGCCAGGAAGGTGTCCTGCCGG - Intronic
1061009376 9:127946130-127946152 CCTCCAGCAATGTGTCCTGGAGG - Intronic
1061268264 9:129521160-129521182 GGTCTTGGAAGGCTTCCTGGAGG - Intergenic
1061398401 9:130355592-130355614 GGCCCTGGAAGGCCTCCTGGAGG + Intronic
1061927446 9:133812867-133812889 GATCCTGGTGGGTGTCTTGGAGG - Intronic
1061987766 9:134139974-134139996 GCCCCCGGAAGGTGTCCAAGGGG - Intronic
1062136313 9:134930194-134930216 CCTCCTGGTAGGTGTGCTTGGGG + Intergenic
1062204988 9:135331346-135331368 GCACATGGCAGGTGTTCTGGGGG + Intergenic
1062710139 9:137971067-137971089 GCTCATGGAGAGTGGCCTGGGGG + Intronic
1185724481 X:2408414-2408436 CCTCCTGGCATGTGCCCTGGAGG + Intronic
1187701353 X:21967221-21967243 GCTCCTGGAAAATGGACTGGAGG - Exonic
1187997354 X:24942428-24942450 CCTCAGGGAAGGTTTCCTGGTGG + Intronic
1188444984 X:30246735-30246757 CCGCCTGGAAGGTCTCATGGAGG + Intronic
1189333498 X:40156583-40156605 GCTGCTGAAAGGGGGCCTGGGGG - Intronic
1191768746 X:64732583-64732605 GCTGCTGCAGGGTGTGCTGGGGG + Intergenic
1192077434 X:68014457-68014479 GTTACTGGAAGGGATCCTGGGGG + Intergenic
1195948666 X:110243212-110243234 GTGGCTGGAAGGTTTCCTGGAGG - Intronic
1196883370 X:120220704-120220726 GCTCCTGGATGGGAACCTGGAGG + Intergenic
1198015769 X:132609169-132609191 GCTCCTGGAAGTAGTGCTGGGGG - Intergenic
1198305904 X:135382921-135382943 GCTTCTGCTAGGGGTCCTGGAGG - Intergenic
1200000626 X:153058113-153058135 GATCCTGGCAGGTGGCCTTGGGG - Exonic
1200118068 X:153777826-153777848 GCCGCTGGAAGCTGGCCTGGTGG - Intronic