ID: 1148340510

View in Genome Browser
Species Human (GRCh38)
Location 17:46870685-46870707
Sequence TGGGGCATACAGAGAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 465}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148340502_1148340510 1 Left 1148340502 17:46870661-46870683 CCCTCTGGTGAGGCTTCCAACTT 0: 2
1: 0
2: 0
3: 10
4: 106
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465
1148340501_1148340510 8 Left 1148340501 17:46870654-46870676 CCGCATACCCTCTGGTGAGGCTT 0: 2
1: 0
2: 0
3: 8
4: 130
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465
1148340496_1148340510 25 Left 1148340496 17:46870637-46870659 CCTGGGGCCTGGCCAGGCCGCAT 0: 2
1: 1
2: 0
3: 86
4: 293
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465
1148340497_1148340510 18 Left 1148340497 17:46870644-46870666 CCTGGCCAGGCCGCATACCCTCT 0: 2
1: 0
2: 3
3: 13
4: 208
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465
1148340503_1148340510 0 Left 1148340503 17:46870662-46870684 CCTCTGGTGAGGCTTCCAACTTC 0: 2
1: 0
2: 3
3: 10
4: 105
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465
1148340499_1148340510 13 Left 1148340499 17:46870649-46870671 CCAGGCCGCATACCCTCTGGTGA 0: 2
1: 0
2: 2
3: 6
4: 58
Right 1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 53
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148340510 Original CRISPR TGGGGCATACAGAGAGGGCA TGG Intronic
900187425 1:1338948-1338970 TGGGGCATGCGGGGAGGGGAAGG - Intronic
900578124 1:3394264-3394286 TGTGGCCTGCAGAGAGGGGATGG + Intronic
900605012 1:3519961-3519983 TGGGGGACACAGGGAGGGGATGG + Intronic
900803535 1:4752448-4752470 TGGGGCTCACAGAGAAGGTATGG - Intronic
900901114 1:5516695-5516717 TGTGGCTTACAGAGGGGGCCTGG - Intergenic
901591554 1:10348315-10348337 TGGGACATACAATCAGGGCATGG + Intronic
901636238 1:10671584-10671606 TGGGGGCCACAGAGAGGGGAGGG - Intronic
901636706 1:10673897-10673919 CAGGCCATCCAGAGAGGGCAAGG - Intronic
902534727 1:17112928-17112950 TGGGGCACACAGAGACAGAAAGG - Intronic
903535728 1:24065015-24065037 TGTAGCATACAGGCAGGGCAAGG - Intronic
903757098 1:25670130-25670152 TGGGGCTTACAGGGAGGCCCTGG - Intronic
903943677 1:26948720-26948742 TGGGGCTCACAGTGAGGTCAAGG - Intergenic
903953640 1:27010931-27010953 TGAGCCATACTGACAGGGCAAGG + Intronic
904308244 1:29604867-29604889 TGGGGCATACACACAGACCAGGG - Intergenic
905000092 1:34661187-34661209 TGGTGCATGCAGGGAGGGGATGG + Intergenic
905249707 1:36640036-36640058 TGGGGGTGACAGAGAGGCCAGGG - Intergenic
906045295 1:42825494-42825516 AGGGGCATACAGACAGGGTGTGG + Intronic
906066772 1:42986339-42986361 TGGGGCCTTCAGTCAGGGCATGG + Intergenic
906775983 1:48530015-48530037 TGGGGGATAGGGAGAGGGGAAGG - Intergenic
906777072 1:48539429-48539451 GGGGTCAGACAGTGAGGGCATGG - Intronic
906952879 1:50348892-50348914 TGGTACATACAGAGATGACAGGG + Intergenic
907046519 1:51303214-51303236 TGAGGCTCCCAGAGAGGGCAGGG + Intronic
907355724 1:53871917-53871939 TGCAGCATACAGAAAGAGCAGGG + Intronic
908001538 1:59685095-59685117 TGGGGGATACGCAGAGGGCAGGG - Intronic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
908560518 1:65301651-65301673 TGGTGCACCCAGAGAGGGCATGG - Intronic
910690387 1:89959674-89959696 TGGCACATCCAGAGAGGGTATGG - Intergenic
910881352 1:91924858-91924880 TGGCGCACCCAGGGAGGGCATGG - Intergenic
912211527 1:107562310-107562332 TAGTGCCTTCAGAGAGGGCATGG + Intergenic
912214577 1:107593468-107593490 TGGAGGATACAGAGCAGGCAAGG - Intronic
912731997 1:112115269-112115291 TGGGGCATCCAGAGATGAGAGGG - Intergenic
913221642 1:116665354-116665376 CGAGCCTTACAGAGAGGGCAGGG + Intronic
913494563 1:119416584-119416606 TGGGGCACACAGAGAGGCAAAGG - Intronic
913555449 1:119962153-119962175 TGGGGAGGACAGAGAGGGTATGG - Intronic
914347980 1:146816042-146816064 TGGAGCCTTCAGAGAGAGCATGG - Intergenic
916480436 1:165209631-165209653 TGGGGTGCACAGGGAGGGCATGG + Intronic
916484275 1:165244166-165244188 GGGTGCATCCAGAGAGAGCATGG + Intronic
916794000 1:168148685-168148707 GTGGGCACAAAGAGAGGGCAAGG + Intergenic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
921714120 1:218400960-218400982 TGGAGCATGCACAGAGGGCTGGG - Intronic
922006374 1:221534683-221534705 TGGCTCACCCAGAGAGGGCATGG - Intergenic
922599441 1:226838476-226838498 TGGCACATTCAGGGAGGGCATGG - Intergenic
922727217 1:227928059-227928081 TGGGTCACAGGGAGAGGGCAGGG - Intronic
923358797 1:233187459-233187481 TGAGGGATACAGAGAGGAGAGGG - Intronic
1064901642 10:20301886-20301908 TGGAGCACCCAGAGAGGGCATGG - Intergenic
1065384154 10:25117034-25117056 TGTGAGATACAGAGAGGGAAGGG - Intergenic
1065727750 10:28682360-28682382 TGGGGCATGTACAGTGGGCACGG + Exonic
1067979811 10:51073211-51073233 TGGGGAATATTGAGTGGGCAGGG + Intronic
1068046548 10:51893438-51893460 GGTGGCATACAGAGAGTGAATGG + Intronic
1069662449 10:70132544-70132566 TGGGGGAGACAGAGAGGGGCGGG + Intronic
1069821224 10:71229856-71229878 TGGGACAGCCAGAGATGGCATGG - Intronic
1070969134 10:80549272-80549294 TGGGGCATGGAGAGAGAGCTGGG + Intronic
1070981603 10:80652873-80652895 TGGAGCACCCAGAGAGGGTAGGG - Intergenic
1071412190 10:85407745-85407767 TTGGGCATGCAGAAAGGACAGGG - Intergenic
1071451083 10:85791898-85791920 GGGGGCATAGGGAGAGGGCTGGG + Intronic
1072039237 10:91591443-91591465 AGGGGGAGACAGAGAGGGTAGGG - Intergenic
1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG + Intronic
1072350858 10:94555525-94555547 TGGCGCATCCAGAAAAGGCATGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072731369 10:97849540-97849562 GGGGGCACACAGAGAGGAAAAGG + Intergenic
1073693588 10:105839415-105839437 TGGGGCAGAGAGAGAAAGCATGG - Intergenic
1073886764 10:108048792-108048814 TGGGACATGAAGAGAGGGTATGG + Intergenic
1074226698 10:111491642-111491664 TGGGGGATAAAGTTAGGGCATGG - Intergenic
1074771650 10:116738873-116738895 AGGGACATACACAGAAGGCATGG + Intronic
1074904509 10:117849689-117849711 AGGGGCACAAAGAGAGGGTAGGG - Intergenic
1076023463 10:127093023-127093045 TAGAGCCTTCAGAGAGGGCACGG - Intronic
1076143533 10:128098107-128098129 TGGGGAACACAGAGAGGACAGGG + Exonic
1076178113 10:128384336-128384358 TGGGGAATTCAGAGTGGGCCTGG + Intergenic
1076713931 10:132353860-132353882 TGAGGCACACAGTGAGGGGAGGG - Intronic
1076980382 11:201022-201044 TGGGTCATACAGGGAGTACAAGG + Intronic
1076981178 11:205671-205693 TTCAGCAGACAGAGAGGGCAGGG + Intronic
1078328469 11:10399104-10399126 TGGTGCATCCAGAGAGGGCATGG - Intronic
1078346685 11:10555908-10555930 AGGGGCATTCTGAAAGGGCAGGG + Intergenic
1078369415 11:10732657-10732679 TACGCCATACTGAGAGGGCACGG - Intergenic
1078461019 11:11515452-11515474 GGCAGCATACAGAGAGAGCAGGG - Intronic
1079321123 11:19452397-19452419 TTTGGAAGACAGAGAGGGCATGG - Intronic
1079995755 11:27293563-27293585 TGGGGGAGGCAGAGAGGGAAGGG + Intergenic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1081997931 11:47376866-47376888 TGGAGCTTGCAGAGAGGGCTGGG + Intronic
1083543016 11:63527862-63527884 TGGAGCACCCAGAGAGGCCATGG + Intergenic
1083860162 11:65416132-65416154 TGCAGCAAAGAGAGAGGGCATGG + Intergenic
1083880020 11:65543775-65543797 TGGGGCAGGGAGAGAGGGCGGGG - Intronic
1083966252 11:66045615-66045637 TGGGGTAAGCAGAGAGGCCAGGG + Intronic
1084592527 11:70098829-70098851 TGGTGGATACACAGTGGGCAGGG - Intronic
1085192913 11:74644451-74644473 TGTGCCCTTCAGAGAGGGCATGG - Intronic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1085663495 11:78391780-78391802 TCAGGAATTCAGAGAGGGCATGG - Intronic
1085743576 11:79096499-79096521 TGGGGCTTACAGAGTGGGGGTGG - Intronic
1086926005 11:92641457-92641479 TAGAGCCTTCAGAGAGGGCATGG - Intronic
1087270619 11:96107842-96107864 TAGGGCACCCAGGGAGGGCATGG + Intronic
1088784050 11:113164694-113164716 TGGTGCACCCAGAGAAGGCATGG - Intronic
1088813598 11:113407290-113407312 AGTGGCACACAGAGAGGGCTGGG + Intergenic
1088917257 11:114237109-114237131 TGGTGAGTACAGAGAGGGCAGGG - Intronic
1089611738 11:119673086-119673108 TGGGGCTTAGAGCAAGGGCATGG + Intronic
1090498016 11:127233551-127233573 CCAGGCACACAGAGAGGGCAGGG - Intergenic
1090596935 11:128330132-128330154 TGTGGCAGTCAGAGAGGGGATGG - Intergenic
1091591768 12:1846693-1846715 TGTGGCAGACAGAGCGGGAATGG + Intronic
1091800745 12:3323197-3323219 TGGGGCAGCCAGAGAGGGGGTGG - Intergenic
1091839996 12:3613971-3613993 TGGGGCACACAGAGAGGGAGAGG - Intronic
1093841195 12:23903288-23903310 TGGGTCAGACACAGAGGGCTTGG + Intronic
1093884651 12:24445792-24445814 TGAGACATACAGGGAGGGCTTGG + Intergenic
1094083603 12:26564773-26564795 TGGAGCCTTCAGAGAGAGCATGG + Intronic
1094596291 12:31869776-31869798 TGGTGTATTCAGAGAGGGCCTGG - Intergenic
1094601491 12:31912735-31912757 TGGCGCACCTAGAGAGGGCAAGG - Intergenic
1095468511 12:42512559-42512581 TGTGGAATAGGGAGAGGGCAGGG - Intronic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1097147299 12:56950672-56950694 TAAGGGACACAGAGAGGGCACGG + Intergenic
1099224185 12:79949452-79949474 TGAGGGATGAAGAGAGGGCAAGG - Intergenic
1099319172 12:81123616-81123638 TGGGGACTATAGAGAGGGGAGGG - Intronic
1100040340 12:90309919-90309941 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1100411793 12:94326187-94326209 TGGCTCACACAGAGAGGGCATGG + Intronic
1101289373 12:103352075-103352097 TGGGGCAAAGAGGAAGGGCAAGG - Intronic
1101375193 12:104165362-104165384 TAGAGCACCCAGAGAGGGCATGG + Intergenic
1101943919 12:109121533-109121555 TGGGGCATAGAGCAAGAGCATGG + Intronic
1102195410 12:111021823-111021845 TTGGGCACACAGAGAGGGAAGGG + Intergenic
1102285928 12:111656599-111656621 TGCAGACTACAGAGAGGGCAAGG + Intronic
1102840594 12:116116418-116116440 TGGCGCACTCAGAGAAGGCATGG + Intronic
1103058842 12:117842764-117842786 TGGGCAAGACAGAGGGGGCAGGG + Intronic
1103254301 12:119527539-119527561 TGGGGCATACAGTGTTTGCAAGG + Intronic
1103871323 12:124094454-124094476 TGGGGAACACAGAGAGAACACGG + Intronic
1104078008 12:125407508-125407530 AGGGACAGACAGACAGGGCACGG - Intronic
1104634084 12:130426912-130426934 TGGGGCACACAGAGGGGTCGTGG + Intronic
1104943349 12:132404966-132404988 TGGGGCTTGCAGAGCCGGCAGGG + Intergenic
1104977338 12:132558039-132558061 TGAGGCCCACAGAGAGGGAACGG - Intronic
1105019640 12:132807765-132807787 TGGGGCCAACAGAGGGGGCGGGG - Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106470536 13:30050313-30050335 TGGAGCCTACAGAGGGAGCATGG - Intergenic
1107162582 13:37248977-37248999 AGGGGCATACACACAGAGCAGGG - Intergenic
1107240521 13:38228750-38228772 TGGTGCACCCAGAAAGGGCATGG + Intergenic
1107555074 13:41510414-41510436 TGGCGCATCCAGAGAGGGTATGG - Intergenic
1107812657 13:44215321-44215343 TGGAGCCTTCAGAGGGGGCATGG - Intergenic
1108830741 13:54475198-54475220 TGGTGCACCCAGGGAGGGCATGG - Intergenic
1112527172 13:100161202-100161224 TGTGGCATCCAGTGTGGGCAAGG + Intronic
1112592476 13:100776340-100776362 CGGTGCATCCAGGGAGGGCATGG - Intergenic
1112629792 13:101148231-101148253 TGGAGCCTTCAGAGAGAGCATGG - Intronic
1113603872 13:111590855-111590877 TGGAGCAGAGAGACAGGGCAAGG - Intronic
1113735086 13:112672670-112672692 TGGGGTGAACAGGGAGGGCATGG + Intronic
1113750394 13:112773015-112773037 TGGGCCATACAGGGAAGGCCTGG + Intronic
1113922237 13:113919586-113919608 TGGGGCCTGCACAGAGGGCTTGG + Intergenic
1115191059 14:30747467-30747489 TGGGGCATCCAGGGAGGTCAAGG + Intergenic
1117969886 14:61241246-61241268 TGGTGCACCCAGAGAGGACATGG - Intronic
1119408060 14:74411034-74411056 TGGGGTATGGAGAGAGGCCAGGG + Intronic
1119703305 14:76769328-76769350 TGGGGCATGCACAGAGGGGCCGG - Intronic
1120069358 14:80085697-80085719 TGGGGCACATGGAGAGGGCAGGG - Intergenic
1120228241 14:81814757-81814779 CATGGCCTACAGAGAGGGCAAGG + Intergenic
1120322398 14:82981081-82981103 TGGGTCACAGAAAGAGGGCATGG + Intergenic
1120398026 14:83993061-83993083 TGTGGAATAGAGAGAGAGCAAGG + Intergenic
1120949412 14:90027290-90027312 TGGGGAAAACAGGGAGGGAAGGG - Intronic
1121423784 14:93833848-93833870 TGTGACAGACAGACAGGGCATGG - Intergenic
1121650285 14:95553150-95553172 GGGAGCAACCAGAGAGGGCAAGG - Intergenic
1122623719 14:103073818-103073840 TGGGGCACAGAGGCAGGGCAGGG + Intergenic
1122781665 14:104146385-104146407 TAGGGCATCTATAGAGGGCAGGG - Intronic
1124086991 15:26560328-26560350 TGGAGAATTCAGAAAGGGCAAGG + Intronic
1124147254 15:27139265-27139287 TGGGGGGTGCAGAGAGGGGATGG + Intronic
1124662737 15:31563497-31563519 TGAGGCCGACAGAGAGGGCCTGG + Intronic
1125519227 15:40338997-40339019 TGGGGAATGCAGGGAGGGCTGGG - Intronic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1126312529 15:47334179-47334201 TGGTGCACCCAGGGAGGGCATGG + Intronic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1127859748 15:62983571-62983593 TGGGGCAGATAGGGAGGGGAGGG - Intergenic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1128744799 15:70106013-70106035 TGGGGCAACCAGAGAGGGGTGGG + Intergenic
1129778691 15:78254505-78254527 TGGTGCATGCAGGGAGGGCATGG + Intergenic
1129914448 15:79256510-79256532 TGGTGCACTCAGAGAGGTCAGGG + Intergenic
1130156983 15:81358976-81358998 TGGGCCATACAAAAAGGCCATGG - Intronic
1130210456 15:81917304-81917326 TGGTGCATACAGGGAGGGCATGG + Intergenic
1130952938 15:88606253-88606275 TAAGGCATACAGAGAGCGCGGGG - Intergenic
1132072957 15:98796014-98796036 TGGAGCAGGCAGAGACGGCACGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132785695 16:1656099-1656121 CTGGGCATCCAGAGTGGGCAGGG + Exonic
1133427238 16:5703326-5703348 TTGGCCATGCAAAGAGGGCAGGG + Intergenic
1133776378 16:8898483-8898505 TGGGTCATAAAGAGAAGGCTCGG - Intronic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1135072284 16:19362605-19362627 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1135090762 16:19514307-19514329 TGGAGCACTCAGAAAGGGCATGG - Intronic
1135885301 16:26300611-26300633 TGGTGTGTCCAGAGAGGGCATGG + Intergenic
1135902056 16:26469633-26469655 TCAGGCACAGAGAGAGGGCAGGG - Intergenic
1135996452 16:27253010-27253032 TGGTGCAAGTAGAGAGGGCACGG + Intronic
1136296924 16:29309095-29309117 GGGGGCATAGGCAGAGGGCATGG - Intergenic
1137410402 16:48223249-48223271 TGAGGCACACAGAGAGGGTCTGG + Intronic
1137589864 16:49686958-49686980 TGGGGCAGACAGAGATGAGAAGG - Intronic
1137886312 16:52107613-52107635 TGGGGCCTACAAATAGGCCAAGG - Intergenic
1138187393 16:54987083-54987105 AGGGGCTTGCAGAGAGGGAAGGG + Intergenic
1138828359 16:60348681-60348703 TGGGGCATTCAGACAGGACCTGG + Intergenic
1139986055 16:70899490-70899512 TGGAGCCTTCAGAGAGAGCATGG + Intronic
1140092175 16:71847488-71847510 TGGGGCAGAAAAAGAGGTCAGGG - Intronic
1140569187 16:76082700-76082722 TGGTGCCTACAGAGATTGCAAGG + Intergenic
1141139579 16:81488607-81488629 AGGGGCACACAGAGAGGGGATGG - Intronic
1141382602 16:83589357-83589379 TGGGGGAGAGGGAGAGGGCAAGG - Intronic
1141407592 16:83807827-83807849 CGGGGCATAGAGGGAGGGGAGGG + Exonic
1142359595 16:89619841-89619863 TGGGGGCTGCAGAGAGGGGAGGG - Intronic
1142752500 17:1997594-1997616 TGGGGAATACCTAGAGGGGACGG - Intronic
1143009361 17:3857433-3857455 TCGGGCAGCCAGGGAGGGCATGG + Intergenic
1143368861 17:6425938-6425960 TGGGGGATACAGAGAGGTTAAGG - Intronic
1143410056 17:6703296-6703318 TGGGGCTTACAGAGAGGAATCGG - Intronic
1143751224 17:9029402-9029424 TGTTGCATGCAGAGAGAGCAGGG + Intronic
1143950967 17:10631873-10631895 TGGAGCAGACGGAGAGGGCCCGG - Exonic
1144642877 17:16948191-16948213 GGAGGCAGAGAGAGAGGGCAAGG + Intronic
1144725243 17:17498564-17498586 TGGGGCATTCAGAATGGGAATGG - Intergenic
1145752871 17:27367759-27367781 TGGGGGAGAAAGAGAAGGCAAGG - Intergenic
1145869015 17:28258479-28258501 TGGGGCATACAGAGAGGGTGTGG - Intergenic
1146630366 17:34465205-34465227 TGGGGCAGACAGACAGAGCCAGG + Intergenic
1146906072 17:36618606-36618628 TGGGACAGACGGAGAGGTCACGG + Intergenic
1147184006 17:38704112-38704134 AGGGGCAAACAGAGAGGAGAAGG - Intergenic
1147186549 17:38716386-38716408 TGGGGAATGCAGAGAAGTCAGGG - Exonic
1147738298 17:42654900-42654922 TGGAGCACCCAGAGAGGGCATGG + Intergenic
1147854889 17:43472160-43472182 TGGGGCATGCAGAGAGTGCAGGG + Intergenic
1147923229 17:43931437-43931459 TGGGGCATACAGAGAGGATGTGG + Intergenic
1147926279 17:43947920-43947942 GGAGGTAAACAGAGAGGGCAGGG + Intergenic
1147952132 17:44113131-44113153 TGGGGCAGGCAGAGAGAGCTGGG - Intronic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148860400 17:50601533-50601555 GGGGGCATGCAGAGTGGCCATGG + Intronic
1149043016 17:52212414-52212436 AGGGTCACACAGAAAGGGCAAGG + Intergenic
1149559941 17:57601423-57601445 TGGGGCACACAGAGTGGCCAGGG - Intronic
1150622884 17:66821791-66821813 TGGAGGATCCAGGGAGGGCATGG - Intergenic
1150944075 17:69725066-69725088 TGGGCCATGGAGAGAAGGCATGG - Intergenic
1151192204 17:72406774-72406796 TGGAGCATCCAGGGAGGACAGGG + Intergenic
1151384278 17:73745649-73745671 AGGGACACACAGAGCGGGCAGGG - Intergenic
1151904107 17:77036400-77036422 TGGCACGTCCAGAGAGGGCAGGG - Intergenic
1152545641 17:80998912-80998934 TGGGGCTGACAGACAGGGCCAGG - Intronic
1152684776 17:81688583-81688605 TGGGGCTGACACAGAGGCCAGGG - Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1153754239 18:8263789-8263811 TGGCACATCCACAGAGGGCATGG + Intronic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155581402 18:27312210-27312232 TAGAGCATTCAGAGAGAGCATGG - Intergenic
1155626914 18:27845332-27845354 TGGAGCCATCAGAGAGGGCATGG - Intergenic
1155788545 18:29933536-29933558 TGGTGCTTCCAGAAAGGGCATGG - Intergenic
1156475766 18:37404451-37404473 TGGGGCATAGACACAGGGCAGGG + Intronic
1156508526 18:37615233-37615255 TGGGGGCTGCAGAGAGGCCAAGG - Intergenic
1156739377 18:40305275-40305297 TTGGGCTTACATAAAGGGCAGGG - Intergenic
1157209039 18:45725588-45725610 TGGAGTATGCAGAGAGGGCTAGG - Intronic
1158028128 18:52928276-52928298 TGGGGCCTACTGAGAGTGGAGGG + Intronic
1159329852 18:66978005-66978027 TGGAGCATACACAGGGGGCTGGG + Intergenic
1160142632 18:76339105-76339127 TGGGGCACACATGGCGGGCAGGG - Intergenic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1160582993 18:79898378-79898400 TGTGGCACACTGAGAAGGCAGGG - Intronic
1160939418 19:1613430-1613452 TGGGGCCCACAGAGTGAGCAGGG - Intronic
1161155008 19:2727987-2728009 TGGGGCAGAGAGAGTGGGCCAGG - Intronic
1161709812 19:5841622-5841644 CGGGGCATACAGGGAGGCAATGG + Intergenic
1161713581 19:5863507-5863529 CGGGGCATACAGGGAGGCAATGG + Intergenic
1161911854 19:7199806-7199828 TCGTGCATACTGGGAGGGCAGGG - Intronic
1162004621 19:7769469-7769491 AATGGCATCCAGAGAGGGCATGG + Exonic
1162588931 19:11578327-11578349 TGTGGGATGGAGAGAGGGCAGGG - Intronic
1162654555 19:12118328-12118350 TGGGACACCCAGAGAGAGCAGGG + Intronic
1162743576 19:12786728-12786750 TGGGCCAGACAGGGAGGGCGGGG - Intronic
1162771173 19:12950095-12950117 TGTGGCATTCAGAGAGGCCTGGG - Intronic
1163265596 19:16218790-16218812 TGGTGTGTCCAGAGAGGGCAAGG - Intronic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165210411 19:34231307-34231329 TGGGGCATGAAGAGAGGGATGGG + Intergenic
1165508001 19:36246938-36246960 TGGTGCAGCCAGAGACGGCATGG - Intergenic
1165773339 19:38390491-38390513 TGGGGCATGCGGGGAGGGTAGGG + Intronic
1166047731 19:40239137-40239159 TGGGGCATTAAGTGAAGGCATGG + Intronic
1166326468 19:42053947-42053969 TGGGGCAGAGGGAGAGTGCAGGG + Intronic
1166708042 19:44919397-44919419 AGGGGCTTCCAGAGAGGGCAGGG + Intergenic
1166955050 19:46458227-46458249 TGAGACACACAGGGAGGGCAGGG + Intergenic
1167427924 19:49439064-49439086 TGGGGTATCCAGGGAGGGGAGGG - Intronic
1167482145 19:49739684-49739706 TTGGGCATAGAGGGAGTGCATGG + Intergenic
1167599494 19:50446056-50446078 TGGGGCCTCCAGGTAGGGCACGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167969236 19:53176385-53176407 TGGTGCACCCACAGAGGGCATGG + Intronic
1168475016 19:56669276-56669298 TCGAGCACCCAGAGAGGGCATGG - Intronic
925264679 2:2558802-2558824 TAGGGCCTTCAGAGAGAGCATGG - Intergenic
925295450 2:2773448-2773470 TGGAGCACCCAGTGAGGGCACGG + Intergenic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
926955514 2:18291085-18291107 TGGTGCACCCAGAGAGGGTATGG - Intronic
927053166 2:19349406-19349428 AGGGGCATTCTGAGAGGGCCAGG + Intergenic
927802276 2:26112109-26112131 TGGCGTATCCAGAGAGGGGATGG - Intronic
929522270 2:42664723-42664745 AGAGGCCTGCAGAGAGGGCAGGG + Intronic
930726707 2:54688643-54688665 TGGAGCATACACAGAGCACAGGG + Intergenic
931441084 2:62290994-62291016 TGGCAAATACTGAGAGGGCACGG + Intergenic
932343566 2:70981616-70981638 TGAGGCATAGGGAAAGGGCAGGG + Intronic
932746517 2:74338053-74338075 TGGGGCATCAAGAGAGGGTCAGG + Intronic
932885651 2:75546978-75547000 TAGAGCCTTCAGAGAGGGCATGG + Intronic
932986635 2:76733716-76733738 TGCTGCACCCAGAGAGGGCATGG - Intergenic
933287714 2:80402230-80402252 TGGTGCACCCACAGAGGGCATGG - Intronic
933776531 2:85774409-85774431 TGGGGCAGGTAGAAAGGGCATGG - Intronic
933987906 2:87608035-87608057 TGGTGCACCCAGGGAGGGCATGG + Intergenic
934766760 2:96884148-96884170 TAGCGCACACAGAGAGGGCCTGG + Intronic
934972376 2:98773868-98773890 TGGCGCATCCAGAGAGAGCCTGG - Intergenic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
935949842 2:108318751-108318773 GGGGGCATGCAGAGAGGAAAGGG - Intergenic
936305934 2:111342773-111342795 TGGTGCACCCAGGGAGGGCATGG - Intergenic
936462436 2:112723057-112723079 TGGGGCAGGCAAAGAGGGGACGG - Intronic
937523467 2:122739036-122739058 TGGCACATCTAGAGAGGGCATGG + Intergenic
938967352 2:136400111-136400133 TGGTGTACCCAGAGAGGGCAGGG + Intergenic
939298080 2:140295862-140295884 TGGGGCAAAGAGAGGGAGCATGG + Intronic
939697437 2:145343932-145343954 AGGGGCATACAGATATGCCATGG - Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941126806 2:161594371-161594393 TTGGCCATATAGAGTGGGCAGGG + Intronic
942146346 2:173031029-173031051 TGGGACACAGAAAGAGGGCAAGG + Intronic
942946704 2:181681158-181681180 TGGGCCTTTCAGAGAGGGCAAGG - Intergenic
943387259 2:187217307-187217329 TGGTGCATCCAGGAAGGGCAGGG + Intergenic
946162069 2:217841395-217841417 TGGGAAACACAGAGAGTGCAGGG + Intronic
946316027 2:218913157-218913179 TGGGGCCTTCAGAGGGAGCATGG + Intergenic
946819643 2:223616748-223616770 TGGGTCTTACATAGAGTGCATGG + Intergenic
947018460 2:225647490-225647512 GGGGTCCTACAGAGAAGGCACGG - Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
949035136 2:241812722-241812744 TGAGGCCCACAGAGAGGACAAGG - Intronic
1168815359 20:733050-733072 TAGGGCTTTCAGAGAGAGCATGG + Intergenic
1168841424 20:912367-912389 TGGGTCCTAGAGGGAGGGCATGG + Intronic
1169038830 20:2476138-2476160 TTGGGAATACAGAGAGAGCTGGG + Intronic
1169296172 20:4401979-4402001 TGGGGGATCCAGAGAGTGAAAGG + Intergenic
1169340800 20:4794948-4794970 TGTGGCCAACAGAGAGGGCTTGG + Intronic
1169396013 20:5230090-5230112 TGGCGCACCCAGGGAGGGCATGG + Intergenic
1169441151 20:5634966-5634988 TGGTGCACCCAGGGAGGGCATGG - Intergenic
1169560124 20:6790857-6790879 TGGGGCATACACATAGACCATGG - Intergenic
1170104395 20:12737780-12737802 TGGGGAAGAGAGACAGGGCAAGG - Intergenic
1170555165 20:17509026-17509048 TGGGACATGCAGAGAGGAAAAGG + Intronic
1170899753 20:20450600-20450622 TGGGGCCCACAGCCAGGGCAGGG - Intronic
1172104182 20:32506333-32506355 TTGGGCAAGCAGAGAGGGCCTGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1173236176 20:41247723-41247745 GGGAGCATACAGGGAGGGCAGGG - Intronic
1173484588 20:43431069-43431091 TGGGGAAGGCAGAGAGGGCAGGG + Intergenic
1174687206 20:52467469-52467491 TGGAGCACCTAGAGAGGGCACGG - Intergenic
1175359977 20:58401949-58401971 TGGGGCAGCCATAGAGGGAATGG - Intronic
1176242627 20:64082202-64082224 AGGGGCAGACAGACAGGGAAGGG - Intronic
1176375210 21:6083613-6083635 TCGGGCCTCCAGAGTGGGCAGGG - Intergenic
1177322791 21:19544272-19544294 TGGCACATCCAGAGAGGGTATGG + Intergenic
1177348248 21:19900675-19900697 TGGGAAATACCCAGAGGGCAGGG + Intergenic
1178255842 21:31051901-31051923 TGGGGCAAAAAATGAGGGCATGG + Intergenic
1178763631 21:35428612-35428634 TGGGGCAGACAGGGAGGGGGAGG - Intronic
1179194212 21:39150508-39150530 TGGTGCACCCATAGAGGGCACGG - Intergenic
1179269746 21:39841464-39841486 TGGGAGATGCAGACAGGGCATGG + Intergenic
1179640840 21:42746387-42746409 TGGGGCCTTCAGAGGTGGCAGGG - Intronic
1179643082 21:42760007-42760029 TGGGGCATAAAGTTAGGGGATGG - Intronic
1179748264 21:43454631-43454653 TCGGGCCTCCAGAGTGGGCAGGG + Intergenic
1180678593 22:17606888-17606910 TGGAGAATACAGAGAAGCCAAGG - Intronic
1180865136 22:19114339-19114361 TGGGGCATGGAGAGAGCCCAAGG - Intronic
1181013247 22:20054357-20054379 GGGGGCATGCAGAGAGCACAGGG - Intronic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181567246 22:23746568-23746590 TGGGGCAGACAGACAGGAGATGG - Intronic
1181967316 22:26666349-26666371 TGGGGCATCAGGAAAGGGCAGGG + Intergenic
1182528787 22:30939434-30939456 TGAGTCATAAAGACAGGGCAGGG - Intronic
1182924265 22:34107868-34107890 TGGGGCATACCCAGAGGGAACGG - Intergenic
1183332560 22:37229268-37229290 GGGGAGCTACAGAGAGGGCAAGG + Intronic
1183366571 22:37410156-37410178 TGCGGCAAACAGACGGGGCAGGG + Intronic
1184255205 22:43282525-43282547 TGTGGTAGAAAGAGAGGGCAAGG - Intronic
1184389852 22:44197029-44197051 CGGGGCCTGCAGAGTGGGCATGG + Intronic
1184776958 22:46628055-46628077 TGGGGCTGGCACAGAGGGCATGG + Intronic
1184847692 22:47099214-47099236 AAGGGCATACACAGAGGGAAGGG + Intronic
1185155893 22:49193313-49193335 AGGCGCACACAGAGAGAGCATGG + Intergenic
949455167 3:4230551-4230573 TGGCGTATCCGGAGAGGGCACGG - Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950423198 3:12910637-12910659 CAGGGCATACAGGGAGTGCAGGG + Intronic
950435154 3:12974925-12974947 TGGGGCACAGAGAGTGGACACGG - Intronic
950822463 3:15775743-15775765 TGGTGCACCCAGAGAGGGAATGG - Intronic
950854450 3:16092020-16092042 TGGGTGGTACAGATAGGGCAGGG + Intergenic
950880442 3:16318725-16318747 TGGGGGATACAGGGTGGGAAAGG - Intronic
951402656 3:22252700-22252722 TGTGTCAGACAGAGATGGCATGG + Intronic
952513071 3:34076435-34076457 TGAGGAACAGAGAGAGGGCAGGG + Intergenic
952989628 3:38820544-38820566 GGTGGCATACAGGGAGGGTAGGG + Intergenic
953797612 3:45997468-45997490 TGGTGCATCCAGGGAAGGCATGG - Intergenic
953842487 3:46400358-46400380 TGGGGCTTCAAGAGAGGTCAGGG + Intergenic
954163605 3:48739207-48739229 TGGGCCATGCAGAGAGGGGTTGG + Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954978030 3:54715347-54715369 TGGTGCATCCAGAGAGGGCATGG - Intronic
955633694 3:61002603-61002625 TGGGGGATAGGGAGAGGGAATGG - Intronic
956560128 3:70565813-70565835 TGGTGCACCCAGGGAGGGCATGG - Intergenic
956829540 3:73031980-73032002 TGGGGGAAACAGAGAGGCTAGGG + Intronic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958264927 3:91426908-91426930 TGGAACACCCAGAGAGGGCATGG + Intergenic
958693554 3:97499128-97499150 TGGGGAGTAAAGAGAAGGCATGG - Intronic
960616043 3:119597120-119597142 TGGGGCAGAGGCAGAGGGCAGGG - Intergenic
961467667 3:127091400-127091422 TCGGGAATTCAGACAGGGCAAGG + Intergenic
961542199 3:127607602-127607624 TGAGGGAGACAGACAGGGCATGG - Intronic
961648341 3:128404661-128404683 TGGGGCACAGAGTGTGGGCATGG - Intronic
961762738 3:129183699-129183721 TGTGGCGGACAGAGAGGGTAGGG - Intronic
961917607 3:130393364-130393386 TGGGGGATACAGTGGGGACACGG - Intronic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
966120418 3:176513743-176513765 TGGGTTATACAGAGAGAGGAAGG - Intergenic
966129214 3:176617588-176617610 TGGTACATACAGAAAAGGCAGGG + Intergenic
966450200 3:180050383-180050405 TGGGGAATATCGAGAAGGCATGG - Intergenic
967240207 3:187431127-187431149 TTGGGTTTACAGAGAGGGCAAGG - Intergenic
967594610 3:191314858-191314880 TGGGGCTCCCAGGGAGGGCATGG + Intronic
968082963 3:195859583-195859605 AGGGGCATCCTGACAGGGCACGG + Intergenic
968726993 4:2252364-2252386 TGAGGCAGCCAGACAGGGCAGGG + Intronic
969059851 4:4425957-4425979 GGGGGCCTGCAGTGAGGGCAAGG - Intronic
969336703 4:6514814-6514836 TGGAGCCTTCAGAGAAGGCATGG - Intronic
969619651 4:8272725-8272747 TGGGGAGGACAGAGAGGGCATGG + Intronic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
972740973 4:41885703-41885725 TGGGGGATAAGGAGAGGGCTTGG + Intergenic
972782898 4:42301391-42301413 TGGTGCATCCAGAGAGGGCATGG - Intergenic
973663073 4:53127849-53127871 TGGTCCAGACAGAGAGGACACGG + Intronic
973847105 4:54924077-54924099 TGGAGCCTTCAGAGAGAGCATGG - Intergenic
974535871 4:63174380-63174402 TGTTGCATCCAGGGAGGGCATGG + Intergenic
974934828 4:68399548-68399570 TGGCGCACCCAGGGAGGGCATGG + Intergenic
975348253 4:73318890-73318912 TGGTGCACCCAGAGAAGGCATGG - Intergenic
976458438 4:85278513-85278535 TGGTGAGTCCAGAGAGGGCATGG + Intergenic
979453447 4:120900060-120900082 TGGTGCACCCGGAGAGGGCATGG - Intronic
980643065 4:135604178-135604200 TTAGGCATATAGTGAGGGCATGG + Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
981643554 4:146972915-146972937 TGGTGCACCCAGAGAGGGCATGG - Intergenic
982084459 4:151819544-151819566 TGGTGCTCACAGGGAGGGCATGG + Intergenic
982178636 4:152729679-152729701 TGAGGCAGACAAGGAGGGCAGGG + Intronic
982575909 4:157109897-157109919 TGGTGTACCCAGAGAGGGCACGG - Intronic
983079982 4:163372952-163372974 TGGCGCACCCAGGGAGGGCATGG - Intergenic
983270640 4:165557662-165557684 TTGGGCATATAGTAAGGGCATGG - Intergenic
983648321 4:170014573-170014595 TGTGGGCTGCAGAGAGGGCAGGG - Intronic
984708316 4:182863799-182863821 TGGGCTCCACAGAGAGGGCAGGG + Intergenic
985035859 4:185839271-185839293 TGGAGCAGAGAAAGAGGGCATGG + Intronic
986459109 5:7951869-7951891 TGGAGCCTTCAGAGAGAGCATGG + Intergenic
987203060 5:15596829-15596851 TGGTGCACCCAGAGAGGGCATGG + Intronic
988537411 5:32081255-32081277 TGGGAAATCCAGAGAGGGCAAGG - Intronic
988694566 5:33608072-33608094 TGGAGCACCCAGAGGGGGCATGG + Intronic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
990515903 5:56530607-56530629 TTTGGCAGTCAGAGAGGGCAGGG - Intronic
991268139 5:64747077-64747099 TGTGGCACACAGAGAGCACATGG - Intronic
993364400 5:87018992-87019014 CTGGGCTTACAGAGTGGGCAGGG - Intergenic
993633626 5:90317872-90317894 TGGATAATCCAGAGAGGGCAAGG - Intergenic
994227075 5:97265239-97265261 TGGAGCACCAAGAGAGGGCACGG - Intergenic
995175252 5:109168561-109168583 TGGTGCACCCAGAGAGGGCATGG + Intronic
996004897 5:118407838-118407860 ATGGGCACACAGAGAGGGCGAGG - Intergenic
996426758 5:123321115-123321137 TGAGGCATCTGGAGAGGGCATGG - Intergenic
996753894 5:126916323-126916345 GGAGGCATACAGAGAGGCAAGGG - Intronic
998149823 5:139750568-139750590 TGGGGCCTGCAGAAAAGGCAGGG + Intergenic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998798141 5:145840455-145840477 TGGTGCATCCAGGGAGGGCATGG + Intergenic
999497652 5:152115855-152115877 TGTGGCCCACAGAGGGGGCAGGG - Intergenic
1001295105 5:170493767-170493789 TGGGGCATGGGGAGAGGGCCAGG - Intronic
1001581153 5:172799493-172799515 AGGGGCATACAGAGATGGAAAGG + Intergenic
1001746387 5:174095839-174095861 TTGGGCATAAAAAGAGGACAGGG - Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1004836501 6:19537651-19537673 TGGGGGCCAGAGAGAGGGCAAGG + Intergenic
1005194857 6:23270963-23270985 TGGTGCACCCAGGGAGGGCATGG - Intergenic
1005619395 6:27606030-27606052 TGGGTCAGAGGGAGAGGGCAGGG - Intergenic
1005989427 6:30893750-30893772 TGGGGCAGAAAGTGAGGTCAGGG - Intronic
1006088170 6:31611779-31611801 TGGGGCAGGCAGAGTGGGCTTGG - Intergenic
1006107743 6:31726992-31727014 TGGGGCAAAGGGATAGGGCAGGG - Intergenic
1006351467 6:33524308-33524330 TGGGGCACCTGGAGAGGGCATGG + Intergenic
1006691949 6:35895930-35895952 TGGTACACCCAGAGAGGGCATGG + Intronic
1007079927 6:39092680-39092702 TGGGGCAGAGAGGGAGGGCTGGG + Intergenic
1007374861 6:41449622-41449644 GGGGCCATGCAGAGAGGGCGGGG + Intergenic
1007609086 6:43137385-43137407 TGGGGTATAGAGAGAAGACAAGG + Intronic
1007628534 6:43259888-43259910 TGGGGGATCCAGAGAGGTCCCGG + Intronic
1007811858 6:44491916-44491938 TGGTGCACCCAGAGAGGGCATGG + Intergenic
1008413921 6:51217286-51217308 TGGAGCTTACAGGGAGGTCATGG - Intergenic
1008634143 6:53392671-53392693 TGGTGCACCCAGGGAGGGCATGG - Intergenic
1008656548 6:53619756-53619778 TGGCACATGCAGAGAGGGCATGG - Intergenic
1008990456 6:57595752-57595774 TGGAACACCCAGAGAGGGCATGG - Intronic
1009179032 6:60494298-60494320 TGGAACACCCAGAGAGGGCATGG - Intergenic
1009330144 6:62409239-62409261 TGGAACATACAGGGTGGGCACGG + Intergenic
1009374242 6:62947728-62947750 TGGTGCACCCAGGGAGGGCATGG + Intergenic
1010970024 6:82253296-82253318 TGGCACACACAGGGAGGGCATGG + Intergenic
1012535013 6:100284702-100284724 TGGTGCATGCAGAGAGGCTAAGG - Intergenic
1012625807 6:101402206-101402228 TGTGCCATACAGAGAGGGAGAGG - Intronic
1014302956 6:119706452-119706474 GGGGGCACAGAGAGAGGTCAGGG - Intergenic
1014806808 6:125838967-125838989 TGGTGCACCCAGAGAGGGCATGG - Intronic
1016178277 6:141108092-141108114 TGGGGGATACAAAGACAGCAAGG - Intergenic
1017176216 6:151507120-151507142 TGGAGCCCACACAGAGGGCAGGG + Intronic
1017407332 6:154134524-154134546 TGGGGATTAGAGGGAGGGCAAGG - Intronic
1018039872 6:159912161-159912183 TGAGGCACAAAGAGAGGGGATGG - Exonic
1019572819 7:1720954-1720976 TGAGGCACAGAGAGAGTGCAAGG - Intronic
1019759221 7:2796978-2797000 GGGGGTATACAGAGTGGTCAAGG + Intronic
1019877697 7:3829346-3829368 AAGGGCATACAGAGAGGAGAAGG + Intronic
1020164837 7:5799648-5799670 TGGTGTACCCAGAGAGGGCATGG - Intergenic
1020330673 7:7013792-7013814 TGGTGCACCCAGAGAGAGCATGG + Intergenic
1021980436 7:26048922-26048944 TGGGACAGAGAGAGAGGGCTTGG + Intergenic
1022473064 7:30693450-30693472 GGTGGCATCCAGTGAGGGCACGG + Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1024360224 7:48460342-48460364 TGGAGCCTTCAGAGAGGACATGG - Intronic
1024541737 7:50480316-50480338 TGGCATACACAGAGAGGGCATGG + Intronic
1024656985 7:51459265-51459287 TGGGGCCTCCTGAGAGGGCAGGG - Intergenic
1025715474 7:63951827-63951849 GGGGGCTTACATAGAGGGGAGGG + Intergenic
1027785838 7:82577604-82577626 TGGTGCACTCAGAGAGGGCCTGG + Intergenic
1032463115 7:132126330-132126352 TGGGGCAGTCACAGAGGGCTGGG + Exonic
1033220671 7:139524565-139524587 TGGGGCATGTGGGGAGGGCAGGG + Intronic
1034399019 7:150849140-150849162 TGGAGGATGCAGTGAGGGCAGGG - Intronic
1034479246 7:151307286-151307308 TGGGGAACACAGGGAGGGCTTGG - Intergenic
1035069511 7:156131621-156131643 TGAGGGTTACAGAGAGGGCGAGG - Intergenic
1035400846 7:158564610-158564632 TGGGGCATGAAGGGTGGGCAGGG - Intronic
1036129809 8:6098588-6098610 TTGTTCATACAGAGAAGGCAGGG - Intergenic
1038820574 8:30948273-30948295 TGGTGCACGCAGAGAGGGCATGG + Intergenic
1040356733 8:46625634-46625656 TGGTGCACCTAGAGAGGGCATGG + Intergenic
1040496167 8:47967316-47967338 TGGGCCACAAAGAGAGGGCAGGG - Intronic
1040762033 8:50859407-50859429 TGGAGCATCCAAAGAGGACATGG + Intergenic
1042229783 8:66544071-66544093 TGGGGGATACAGAGCGGGCTTGG + Intergenic
1042472196 8:69203543-69203565 TGCAGCATACAGAGAGGCTAAGG - Intergenic
1042929348 8:73997880-73997902 TGGTGCACCCAGAGAGGACATGG - Intronic
1043349354 8:79341543-79341565 TGGGGCCAACAGAGAAGGGAAGG - Intergenic
1043654541 8:82645942-82645964 TGGTGCACCCAGGGAGGGCATGG - Intergenic
1044250797 8:90001904-90001926 TGGGGCACAAAGAGAGGACCCGG + Intronic
1045331899 8:101162370-101162392 TGGTACACCCAGAGAGGGCATGG + Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1047621548 8:126612984-126613006 GGTGGCACCCAGAGAGGGCATGG - Intergenic
1047785101 8:128146513-128146535 TGGGGCAGATAGAGAAGACAGGG - Intergenic
1048019013 8:130521164-130521186 TGGGGAAAACAAAGCGGGCATGG + Intergenic
1048191410 8:132293087-132293109 CGGTGCATCCAGGGAGGGCATGG + Intronic
1048247871 8:132829102-132829124 TGGGGAATACAGACAGGGTGCGG + Intronic
1048996772 8:139799490-139799512 TGGGTGATTCAGAGAGGGTAAGG - Intronic
1049180561 8:141219908-141219930 AGGGGCATGCGGAGGGGGCACGG + Intronic
1049778706 8:144417844-144417866 GGGAGCCCACAGAGAGGGCAGGG - Intergenic
1052997253 9:34557781-34557803 TGGGGTATGGACAGAGGGCATGG + Intronic
1056544608 9:87603226-87603248 TGGGGCATACGGAGAGAAGAGGG - Intronic
1056578721 9:87874812-87874834 TGGTGCACCCAGTGAGGGCATGG - Intergenic
1056722186 9:89081931-89081953 GGGTGGATACAGAGAGGTCAGGG + Intronic
1056766056 9:89445472-89445494 TGGGGCCTCCAGAGCGAGCATGG - Intronic
1056948715 9:91024687-91024709 TGGGGCATCCAGGCAGGGCATGG + Intergenic
1058723371 9:107778938-107778960 TGGGACATAAAGAGAGGCCATGG + Intergenic
1058726924 9:107813327-107813349 TGGTACACTCAGAGAGGGCATGG - Intergenic
1059336538 9:113572595-113572617 TGGGGCAGACAGATAAGGCAAGG + Intronic
1060203129 9:121663769-121663791 GGGGACATAGAGAGAGGCCAAGG + Intronic
1060528734 9:124335065-124335087 GGGTGCACACAGAGATGGCAGGG - Intronic
1060762959 9:126271438-126271460 GGGAGCAGACAGAGAGGCCAGGG + Intergenic
1061181471 9:129027516-129027538 TGGGGGATGGAGAGAGGGCTGGG - Intronic
1061544147 9:131294094-131294116 AGGGGCAAGCAGGGAGGGCATGG - Intronic
1062246940 9:135573947-135573969 TGGGGAATAGAGAAATGGCAGGG + Intergenic
1186487207 X:9942658-9942680 TGGAGCACCCAGGGAGGGCATGG - Intronic
1188597772 X:31922248-31922270 TGGTGCACTCAGGGAGGGCATGG + Intronic
1188735389 X:33707473-33707495 TGTGGCAGACAGAGGGAGCAAGG - Intergenic
1189091156 X:38084241-38084263 TGGTACACACAGGGAGGGCATGG + Intronic
1189509974 X:41652727-41652749 TGGTGCATCCACAGAGGGCATGG + Intronic
1189948468 X:46204118-46204140 TGGGACATCCAGGAAGGGCATGG + Intergenic
1190757642 X:53414685-53414707 TGGAGCAGACAGAGTGGGGATGG + Intronic
1192502641 X:71663965-71663987 TGGGGGAGACAGGGAGGACAGGG - Intergenic
1192552662 X:72066507-72066529 TGGGGCTTACAGAGAGGAGGAGG + Intergenic
1193269347 X:79511055-79511077 TAGTGCCTTCAGAGAGGGCATGG + Intergenic
1193753928 X:85382990-85383012 TGGAGCATAACGAGAGGACATGG - Intergenic
1195618433 X:106930780-106930802 TGGGGGATACAGAGAGGTCTAGG - Exonic
1196693442 X:118585330-118585352 TAGAGCATTCAGAGAGAGCATGG - Intronic
1197034175 X:121854304-121854326 TGTGGCAGGGAGAGAGGGCATGG - Intergenic
1198167171 X:134069352-134069374 TGGAGCCTTCAGAGAGAGCATGG + Intergenic
1199237466 X:145507505-145507527 TGGTGCACCCAGGGAGGGCATGG + Intergenic
1201560396 Y:15310165-15310187 TGGGGGTTACAGAGAAGCCAGGG + Intergenic