ID: 1148340521

View in Genome Browser
Species Human (GRCh38)
Location 17:46870753-46870775
Sequence GAGCTGTGCCCTTGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 2, 1: 0, 2: 2, 3: 28, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148340513_1148340521 19 Left 1148340513 17:46870711-46870733 CCAGCCAGATGTCCTGGCTAAGG 0: 1
1: 0
2: 2
3: 8
4: 231
Right 1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG 0: 2
1: 0
2: 2
3: 28
4: 246
1148340512_1148340521 22 Left 1148340512 17:46870708-46870730 CCTCCAGCCAGATGTCCTGGCTA 0: 1
1: 0
2: 2
3: 17
4: 180
Right 1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG 0: 2
1: 0
2: 2
3: 28
4: 246
1148340517_1148340521 7 Left 1148340517 17:46870723-46870745 CCTGGCTAAGGCAGGTGACTCCA 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG 0: 2
1: 0
2: 2
3: 28
4: 246
1148340515_1148340521 15 Left 1148340515 17:46870715-46870737 CCAGATGTCCTGGCTAAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG 0: 2
1: 0
2: 2
3: 28
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148340521 Original CRISPR GAGCTGTGCCCTTGGCTCAG AGG Intronic
900145759 1:1158099-1158121 GAGCTGTGTCCCTGCCTGAGGGG + Intergenic
900198822 1:1393108-1393130 GAGCTGTTGACTTGGCGCAGGGG - Intronic
900230127 1:1552498-1552520 GAGCTGTGCCCCACGCCCAGAGG + Intronic
900272697 1:1800537-1800559 GTGCTGTCCCCGAGGCTCAGGGG - Intronic
900645830 1:3708314-3708336 GACCTGAGCCCTTGGCACGGTGG - Intronic
901185451 1:7369848-7369870 GGGCTGTGCCCTGGGCTCCTAGG - Intronic
903242358 1:21991830-21991852 GAGCTGTGGGCTGGGCGCAGTGG + Intronic
903245870 1:22015017-22015039 GAGCTGTGGGCTGGGCGCAGTGG + Intergenic
903552739 1:24169345-24169367 GAGCTGTGCTCAGTGCTCAGTGG - Intronic
903995016 1:27300237-27300259 GAGCTGTGCCCTTGGAGAAGGGG + Intronic
905473117 1:38207705-38207727 GAGCTATGGCCTGGGCTAAGCGG + Intergenic
906201252 1:43961769-43961791 CTTCTGGGCCCTTGGCTCAGGGG + Intronic
906301294 1:44683674-44683696 GATCCATGCCCTTGGCTTAGTGG + Intronic
906544985 1:46614278-46614300 GATCAGGGCCCTAGGCTCAGAGG + Intronic
908595579 1:65685749-65685771 CAGCTATGCCCTTCCCTCAGAGG + Intergenic
909823266 1:80093074-80093096 GAGCTGTGCTCTTGGCCCCAGGG + Intergenic
911008537 1:93253595-93253617 GAGCTGGGACCTTTGCTGAGGGG + Intronic
913255127 1:116945905-116945927 GTTCTGGGCCCTTGGGTCAGAGG + Intronic
916821990 1:168408776-168408798 TAGCTCTGGTCTTGGCTCAGAGG + Intergenic
917537900 1:175887780-175887802 GAGGCGAGCCTTTGGCTCAGTGG + Intergenic
917959217 1:180129041-180129063 GAGCCTTCCCCTTGGCTCCGAGG + Intergenic
918463955 1:184802894-184802916 GGTCTGTGGCCTCGGCTCAGTGG + Intronic
919624282 1:199896066-199896088 GTGCTGTGCCAATGGTTCAGTGG - Intergenic
919785158 1:201254075-201254097 GAACTGGGCCCTGGGCTCAGAGG - Intergenic
920552081 1:206870598-206870620 GAGCTGTGTCTTTAGCTCTGTGG - Intergenic
922741052 1:228014421-228014443 GAGCCGTGCCCTTGGTACATGGG + Intronic
923046805 1:230361790-230361812 GAGCTGGGACCCAGGCTCAGAGG + Intronic
924109836 1:240687909-240687931 GATCTGTGCTCTTGGCACAACGG + Intergenic
1062992763 10:1835525-1835547 GAGTCGTTCCCTTGGCTCAGAGG + Intergenic
1064622797 10:17231369-17231391 CATCTGTCCCCTTGGCTAAGGGG + Intronic
1067152622 10:43749159-43749181 GCCCTGCGCCCTTGGCTCCGGGG - Intergenic
1067682576 10:48450187-48450209 GAGCCGTGCTCTTGGCACATGGG - Intronic
1067775623 10:49162990-49163012 GAGTGCTGCCCTTGGGTCAGCGG + Intronic
1071780634 10:88840538-88840560 GAACTTTGCCTGTGGCTCAGAGG + Intronic
1072620911 10:97078701-97078723 CTGCTGTGCCCTTGCCTTAGTGG - Intronic
1073263363 10:102207470-102207492 GAGCTGTGACCTTTGGTCAAGGG - Intergenic
1073993370 10:109289077-109289099 AAGCCTTGCCCTGGGCTCAGAGG + Intergenic
1076042835 10:127265987-127266009 GAGCTGAGGGCTTGGATCAGGGG + Intronic
1076187518 10:128460861-128460883 GAGCTCTGCTCCTTGCTCAGGGG - Intergenic
1076887750 10:133270340-133270362 AAGGTGAGCCCCTGGCTCAGAGG - Exonic
1076904971 10:133357124-133357146 GAGCGGTGCTCCTGGCTCTGAGG - Intronic
1080858306 11:36131048-36131070 GAGCTGTGCAGTTGGCTCAAAGG + Intronic
1083163515 11:60869762-60869784 GAGCTGTGCCCTGGGTCCAGTGG - Exonic
1083386344 11:62313057-62313079 GAGCTGTGGCCTTTGGTCAAGGG - Intergenic
1083612646 11:64011460-64011482 GAGCTGTGTCCCTGGCTCCCAGG + Intronic
1084143292 11:67248887-67248909 GTGCTATGACCTTGGCCCAGAGG + Intronic
1084517799 11:69645888-69645910 CAGGTGCGCCCTTGGCTCCGTGG + Intronic
1084958509 11:72703929-72703951 GGGATGTGCCCTTGGCCCAAGGG + Intronic
1085023873 11:73225363-73225385 TGGCTCTGCCCTTGGCTCACTGG + Intronic
1085528906 11:77180116-77180138 CAGCCCTGCCCTTGGCTGAGAGG - Intronic
1088710008 11:112499407-112499429 GAGCAGCCCACTTGGCTCAGAGG + Intergenic
1090717584 11:129443810-129443832 GGGCTTTGACCTTGTCTCAGTGG - Intronic
1092100685 12:5881393-5881415 TGGCTGTGCCCTTGGCTCCAGGG - Intronic
1092610566 12:10167979-10168001 GAGAAGTGCCCTTGACTTAGTGG - Intronic
1095944906 12:47748296-47748318 TACCTGTGCTCTTGGCTTAGTGG - Intronic
1097007206 12:55927903-55927925 GGGCTGGGCCCTAGGGTCAGAGG + Exonic
1097087553 12:56479750-56479772 GAGCAGTGCCCTTGTTTCTGGGG + Intronic
1097193827 12:57233080-57233102 GAGCTGTGCCCTTGGGGCCCAGG + Intronic
1098973331 12:76878406-76878428 GAGCAGTACCCTGGGCTCGGGGG + Intronic
1102535503 12:113577617-113577639 GTGCTGTGCCCTGGGCTCAGAGG - Intergenic
1102959104 12:117080578-117080600 GAGCTGAGCCCTTGGCTCTAGGG - Intronic
1103607880 12:122100778-122100800 GGTCTGTGCACTTGACTCAGAGG - Intronic
1103985195 12:124762268-124762290 GAGCCGTTCCCTTTGCTCTGGGG - Intergenic
1104834790 12:131781970-131781992 CAGCTATGCCCTTGGCCCTGTGG - Intronic
1108696248 13:52905010-52905032 GAGCAGTGCCCTGGGCTCCGGGG + Intergenic
1112559917 13:100503614-100503636 GAGCTGTGGGCTGGGCACAGTGG + Intronic
1113272183 13:108685786-108685808 GACCTGTGTCCTTGGCTTACAGG + Intronic
1114551511 14:23535146-23535168 GAGCTGTCCCCCTGGCTCTGAGG + Exonic
1114559766 14:23581068-23581090 GAGCTCTGCCCCCTGCTCAGCGG + Intergenic
1114677482 14:24453485-24453507 CAGCTGTGCCCTTCCCCCAGAGG + Intergenic
1114696288 14:24630553-24630575 GAGCTGAGCCTTGAGCTCAGAGG + Intergenic
1118312098 14:64701720-64701742 GCTCTGTGCTCCTGGCTCAGAGG - Intergenic
1119788795 14:77331176-77331198 GAGCTAGGCCCTCAGCTCAGTGG - Exonic
1119873043 14:78033013-78033035 GAGGTGTGCACCTGGCTGAGTGG - Intergenic
1121339081 14:93094334-93094356 CACCTATGCCCATGGCTCAGAGG + Intronic
1123034909 14:105467997-105468019 GGGCGGGGCCCTGGGCTCAGAGG + Intronic
1123067525 14:105626106-105626128 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123071542 14:105644830-105644852 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123091205 14:105743111-105743133 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123096973 14:105771446-105771468 GAGCTGGGCCCAGGGCGCAGAGG + Intergenic
1123917981 15:25051352-25051374 GGTCTGTGCCCATTGCTCAGTGG + Intergenic
1124639688 15:31389825-31389847 GAAATGTGCCCCTGGCCCAGCGG - Intronic
1125533591 15:40429542-40429564 GCACTTTGCACTTGGCTCAGTGG + Intronic
1127467541 15:59258796-59258818 GTGCTGTGATCTTGGCTCACAGG - Intronic
1128139399 15:65287777-65287799 GTGCTGGGCCCTGGACTCAGAGG + Intronic
1130910294 15:88266085-88266107 GAGTTAGGCCCTTGGCACAGTGG + Intergenic
1132236052 15:100222543-100222565 AAGCTGTGTGCTTGGTTCAGGGG - Intronic
1132355561 15:101168854-101168876 GAGCTGTGTGCTTGGCACTGTGG - Intergenic
1132855706 16:2043750-2043772 GGGCTGTGCCCTTGCCTCCAAGG - Intronic
1134040014 16:11061143-11061165 GAGCTGTGACCTTGAGCCAGCGG + Intronic
1134192075 16:12129561-12129583 GAACTGTGTCCTGGGCTCAGTGG + Intronic
1135665365 16:24331163-24331185 GGGCTGGGCTCTTGGCTCTGAGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137722419 16:50635236-50635258 GAGCTGTGACCTTTGCTTAAAGG + Exonic
1138503438 16:57463223-57463245 ACCCTGTGCCCTTGGCTCAGTGG + Intronic
1138873867 16:60926191-60926213 GAGCTGTGTCCTCTGCTCATTGG + Intergenic
1139601788 16:67991789-67991811 GATCTCTGCCCCTGCCTCAGCGG + Intronic
1140199696 16:72885198-72885220 GAGCTCTGCCCTTATGTCAGTGG - Intronic
1140312984 16:73867022-73867044 GGGCTATGTCCTTGGCCCAGAGG + Intergenic
1140473766 16:75228616-75228638 CAGCGGTGCCCTCGGCTCACAGG + Intronic
1141481093 16:84307514-84307536 GAGCTGTGCCGCCGTCTCAGAGG - Intronic
1141922549 16:87145760-87145782 GACCTTTGCCCTTGGCTCCTGGG + Intronic
1142111074 16:88331988-88332010 CAGCTCTGCTCTTGGCACAGTGG - Intergenic
1142362448 16:89633868-89633890 GGGCTGTGCCCCTGTCTCGGGGG - Intronic
1142900684 17:3009618-3009640 GAGCTGTGCCCTGCTCTCTGCGG - Intronic
1143102926 17:4514062-4514084 GAGCTGGGCCCTTGGCTCCCTGG + Intronic
1143316750 17:6038664-6038686 GTGGTGTGACCTTGGCTCACTGG - Intronic
1144057210 17:11553990-11554012 GAGAGCTGGCCTTGGCTCAGGGG + Intronic
1145869005 17:28258411-28258433 GAGCTGTGCCCTTGGCTCAGAGG - Intergenic
1145982826 17:29024077-29024099 CAGCTGTGCCTTTAGCTCTGCGG - Intronic
1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG + Intronic
1149267712 17:54945508-54945530 GACCTGTGCCATTGTCTCATAGG + Intronic
1150380040 17:64713213-64713235 GAGCCTTGCCACTGGCTCAGTGG + Intergenic
1150639961 17:66942781-66942803 GCCCTGTGCCCTGGGCTAAGTGG - Intergenic
1151122225 17:71805899-71805921 GAACTCTGCCTTGGGCTCAGTGG - Intergenic
1152861653 17:82699797-82699819 GAGGTCTGCCCTTCGCTCTGAGG + Intergenic
1154356855 18:13628006-13628028 GAGGTGGGCCCCAGGCTCAGGGG + Intronic
1157520947 18:48345093-48345115 GCGCTGGACCCTTGGCTTAGAGG - Intronic
1158549512 18:58423214-58423236 GAGATGAGGCCTTGGCACAGAGG - Intergenic
1160059172 18:75514133-75514155 GACCTGGGCCCCTTGCTCAGTGG - Intergenic
1160902540 19:1435842-1435864 GAGCTGGGCCCATCCCTCAGTGG + Intergenic
1160996035 19:1882227-1882249 GAGCTCTGTCCTTGCCTCAGCGG - Intronic
1161007832 19:1945219-1945241 GAGCTGTGTCCTGGGCCCACAGG + Intronic
1161377914 19:3949647-3949669 CCGCTGTGCCCCTGGCTCAGTGG + Intergenic
1162563926 19:11434881-11434903 GGGCTGTGCCCTTGCCTCGGAGG + Exonic
1163426796 19:17244805-17244827 GTGCTGTGCCCCTATCTCAGAGG + Intronic
1165118002 19:33540710-33540732 GAGCAGGGGGCTTGGCTCAGCGG - Intergenic
1165133743 19:33650588-33650610 GTGGTGTGACCTTGGCTCACTGG + Intronic
1165164298 19:33840623-33840645 GGGCTGTGCCTGTGGCTCAGAGG - Intergenic
925889820 2:8424485-8424507 GAGCTGTGCCCATGCCACATGGG - Intergenic
928101524 2:28440155-28440177 GGGCTGAGCCCTGGGCGCAGTGG + Intergenic
928240487 2:29581487-29581509 GAGGTGTTCCCCTGGCTCTGGGG - Intronic
933639908 2:84747937-84747959 CAACTCTACCCTTGGCTCAGAGG - Intronic
933997216 2:87678933-87678955 TGGCTGTGCCCTTGTCCCAGAGG - Intergenic
934939542 2:98490434-98490456 GAGCTGTGTCCATCCCTCAGCGG + Intronic
935066017 2:99648786-99648808 GAGCTGTGCCCTTGGCTGACTGG - Intronic
936028950 2:109056043-109056065 GAGCTGTTGGCTGGGCTCAGTGG - Intergenic
936094078 2:109518470-109518492 GAGCTGGGCCGTAGGCTCTGGGG - Intergenic
936296635 2:111271977-111271999 TGGCTGTGCCCTTGTCCCAGAGG + Intergenic
936350244 2:111706954-111706976 GAGGTGTTCCCTGGGCTCATAGG - Intergenic
938106891 2:128537766-128537788 GAGCTCTGCCCTGAGCTCAGTGG + Intergenic
940816566 2:158303809-158303831 GAGCTGTGGCCTTGATTCAGTGG + Intronic
940891591 2:159041368-159041390 CAGCTGTGCCCTTCCCCCAGAGG + Intronic
940988386 2:160072733-160072755 AAGCTGTGCCCTTGGGACAGAGG + Intergenic
946852503 2:223920741-223920763 GAGTTTGGCCCTTGCCTCAGTGG + Intronic
947869775 2:233428142-233428164 GAGGTGGGCCCTTGCCTAAGGGG + Intronic
948597244 2:239087903-239087925 GCGTGGTGCCCTTGGCTCAGGGG + Intronic
948861130 2:240753044-240753066 GAGCAGAGCCCTGGGCTCTGGGG + Intronic
1169437113 20:5602409-5602431 GAGGTGAGCACTTGGCTCAAGGG + Intronic
1171420998 20:25017647-25017669 GGGCTGGCCCCCTGGCTCAGAGG + Intronic
1172068121 20:32235885-32235907 GAGCTCTGGGCCTGGCTCAGTGG - Exonic
1172707296 20:36891557-36891579 GAGGTGTGCCCTGGGCACAGGGG + Exonic
1173073437 20:39792781-39792803 GACCTGTCCTCTTGGCACAGTGG - Intergenic
1174670042 20:52298609-52298631 GAGCGTTGCCCTTGACCCAGTGG + Intergenic
1175183197 20:57162695-57162717 GAGAAGGGTCCTTGGCTCAGAGG + Intergenic
1176014646 20:62924290-62924312 GCACTGTGCCCTTGCCTGAGAGG - Intronic
1178323398 21:31623438-31623460 GGGCTTTGCCCTTGGCTCTTGGG - Intergenic
1180210493 21:46293041-46293063 GACCTGTGCCCGGGACTCAGTGG + Intronic
1180210701 21:46294151-46294173 GACCTGTGCCCGGGACTCAGTGG + Intronic
1180920701 22:19520125-19520147 CACCTGTGCCCCTGCCTCAGTGG - Intronic
1181054887 22:20256230-20256252 CCTCTGTGCCCTGGGCTCAGTGG - Intronic
1181658545 22:24321925-24321947 AGGCTCTGCCCCTGGCTCAGTGG + Exonic
1181722921 22:24789776-24789798 GACCTTTGCCCTTGGCTCATGGG - Intergenic
1182330185 22:29546111-29546133 GAGCTTGGCCTGTGGCTCAGAGG - Intronic
1183433894 22:37782280-37782302 GAGCTGGTCCCTGGCCTCAGGGG - Intergenic
1184689301 22:46110229-46110251 CAGCTGACCCCTTGCCTCAGTGG + Intronic
1184861373 22:47174856-47174878 GGGCTGTGTCCTTGGCTCCAGGG + Exonic
1185210855 22:49569793-49569815 GTGCTGTGCACCTGGCCCAGCGG + Intronic
950031142 3:9854546-9854568 GAGCTGGGCCCTTGGTTGTGGGG - Intronic
950443942 3:13025403-13025425 GAGCTGTGCCCTGCCCTCAAAGG - Intronic
950527566 3:13533287-13533309 GTGCTGTGTCCTGGGCTCATCGG - Intergenic
950948520 3:16975685-16975707 GAGGTGTGCCCTTAGCTGAAAGG + Intronic
950969140 3:17168965-17168987 GCGCTGTGCCCTTGGCCTGGAGG + Intronic
951530236 3:23692108-23692130 AAGCTGTTGCCTGGGCTCAGTGG - Intergenic
952950057 3:38515619-38515641 CAGCTGCGCCCAGGGCTCAGTGG + Intronic
953115927 3:39992424-39992446 TAGCTGTGCCCTTGGGGGAGAGG - Intronic
953654869 3:44842310-44842332 GGGGTGTGCACATGGCTCAGGGG + Intronic
953878245 3:46678581-46678603 CAGCTGTGCCCACGTCTCAGGGG + Intronic
954421646 3:50422041-50422063 AAGCAGTGCCTTTGGGTCAGGGG - Intronic
954435131 3:50491878-50491900 GACCTCTGCCCTTGGCTGACTGG + Intronic
954654352 3:52184913-52184935 GGGCTGTGACCTTGTCACAGAGG - Intergenic
955745723 3:62138691-62138713 GAGCTTTGCCCTTGTCACTGAGG - Intronic
956576542 3:70758436-70758458 GATGTGAGCCCTTTGCTCAGAGG + Intergenic
960944427 3:122956541-122956563 GACCGGTGCCCTCTGCTCAGGGG + Intronic
961472059 3:127121570-127121592 GACCTGGGCCCTGGCCTCAGAGG + Intergenic
961727547 3:128942604-128942626 GGGCTCTGCCCTTGGCTCCTGGG - Intronic
962414306 3:135168328-135168350 GAGCTGTGCCTGTGGCCTAGAGG - Intronic
964674549 3:159263161-159263183 GAGCTGTGCCCCTGGCTACACGG + Intronic
965609582 3:170530465-170530487 GAGCTTGGCCCTGGGCTCCGTGG + Intronic
966485926 3:180469425-180469447 GGGCTGTGTGCTTGGCTCTGAGG - Intergenic
966554261 3:181241468-181241490 GACCTCTGCACTTGCCTCAGAGG + Intergenic
968206538 3:196807245-196807267 GGGCTGTGCTCCTGGCACAGCGG + Intronic
968977090 4:3827687-3827709 GAGCTGTGCCCAGGGCTCCCAGG - Intergenic
970982453 4:22116254-22116276 GATCTGTTCCCTTCACTCAGAGG - Intergenic
975713482 4:77183559-77183581 GATCTGTGACCTTGGTTGAGAGG + Intronic
981734390 4:147934045-147934067 GAGTTGGGACCTTGGCTGAGGGG + Intronic
981755685 4:148139682-148139704 GCACTGTGCACTTGGATCAGTGG - Intronic
982082133 4:151800742-151800764 CAGCTGTGGCCTAGGCTCAGCGG + Intergenic
983273351 4:165589070-165589092 TTGCTGTGCCCTTTGCACAGTGG + Intergenic
983659026 4:170113476-170113498 GGGCTCTGCTCTGGGCTCAGTGG + Intergenic
1202763913 4_GL000008v2_random:135539-135561 GAACTGTGGCTGTGGCTCAGGGG - Intergenic
985579363 5:688916-688938 CAGCGGTGCCCTGGGCTCAGGGG + Intronic
985594209 5:780975-780997 CAGCGGTGCCCTGGGCTCAGGGG + Intergenic
985966041 5:3339405-3339427 GGTCTGTGCACTTGGCACAGGGG + Intergenic
987403707 5:17503332-17503354 CAGCTGTGACCTGGGTTCAGTGG - Intergenic
987987757 5:25170979-25171001 GAGCTATGCCCTAGGAACAGAGG - Intergenic
990926939 5:61036741-61036763 GAGTTGTGACCTTGGGCCAGTGG + Intronic
992640841 5:78767231-78767253 GACCTGTGTGCTTGGATCAGAGG + Intronic
992788153 5:80189402-80189424 GATTTGTGTCTTTGGCTCAGAGG - Intronic
996151203 5:120036939-120036961 GAGCAGGGGCCTTGGCTCTGTGG + Intergenic
996414710 5:123197852-123197874 GAGCTTTGCCCTGAGGTCAGTGG - Intergenic
996515658 5:124366540-124366562 AAGCTGTGACCCAGGCTCAGGGG - Intergenic
997351789 5:133236268-133236290 GAGATGGGCCCTGGGCTCTGAGG + Intronic
997530795 5:134580026-134580048 GAGCTGTGCCATTTACTCAGGGG + Exonic
998525770 5:142841919-142841941 GAGCTCTGCTCTTGGTTTAGGGG + Intronic
999111285 5:149123477-149123499 CAGCTGTGCCCTGCCCTCAGAGG - Intergenic
1000139082 5:158383837-158383859 GAGCTGAGCCCTGCCCTCAGGGG + Intergenic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1001398771 5:171434476-171434498 GAGCTCTGCCATGGGCTGAGTGG + Intronic
1002614174 5:180440264-180440286 GATCAGTGCCTGTGGCTCAGCGG - Intergenic
1003016896 6:2475326-2475348 GAACTGTCACCTTAGCTCAGGGG + Intergenic
1003628781 6:7767974-7767996 ACCCTGTGCCCTGGGCTCAGTGG + Intronic
1006129288 6:31859698-31859720 GAGCTGTGCCACTGCCACAGGGG - Exonic
1006642417 6:35496229-35496251 GCGCTGTGAGCTTGGCTCGGAGG - Intronic
1007833848 6:44659218-44659240 GAGGTGTGCCCTTGTGGCAGAGG - Intergenic
1007949685 6:45860212-45860234 GTGCTGTGCCCTGTGCTCATGGG + Intergenic
1007976478 6:46106524-46106546 GAGCTTTGCCCTGAGGTCAGTGG + Intergenic
1014490104 6:122052650-122052672 GAGCTGTACCTTTTGCACAGTGG + Intergenic
1014938662 6:127413183-127413205 CAGCTGTGCCCTGCCCTCAGAGG + Intergenic
1017488794 6:154926109-154926131 CTGCTGTGCCCTTGGCCCAGAGG - Intronic
1018327645 6:162690414-162690436 GAGCTGTGCTCTTAACTAAGAGG - Intronic
1019178741 6:170174683-170174705 GAGAGGTCCACTTGGCTCAGGGG + Intergenic
1022299865 7:29092922-29092944 GAGCTTTGCCCTGGGGTCAGTGG + Intronic
1023098715 7:36690691-36690713 GAGCTATGCATTTTGCTCAGTGG + Intronic
1023838661 7:44082889-44082911 GGGCTGTGTCCTTGGCGCCGGGG + Intergenic
1026275525 7:68872460-68872482 GAACTGTGCCCAGTGCTCAGGGG - Intergenic
1026607361 7:71827344-71827366 CTGCTGTGCTCCTGGCTCAGAGG - Intronic
1027361538 7:77415673-77415695 GAACCGTGTCCGTGGCTCAGGGG - Intronic
1027521132 7:79209586-79209608 TAGTTGTGCCCTTGGGGCAGAGG - Intronic
1028630015 7:92924812-92924834 GAGCTATGCCCTGCCCTCAGAGG + Intergenic
1030196433 7:106858009-106858031 AAGCTCTGCCCTTGGCATAGTGG - Intergenic
1031836161 7:126684436-126684458 GAGCTCTGCACTTGGGACAGAGG + Intronic
1031872508 7:127102533-127102555 TAGCTCTAGCCTTGGCTCAGAGG + Intronic
1032827188 7:135582542-135582564 GTGGTGTGACCATGGCTCAGTGG + Intronic
1034841887 7:154405659-154405681 GAGCTGGGCACTCTGCTCAGGGG + Intronic
1035115823 7:156523078-156523100 GACCTGTGCCCCTGGATCAGCGG - Intergenic
1035344655 7:158190267-158190289 CAGCTCTGTCCTTGGGTCAGAGG - Intronic
1037588825 8:20296192-20296214 GGGCTGTGCACTTGGCTCCCTGG - Intronic
1038415440 8:27391586-27391608 GTACTGTGCCCCTGGCACAGGGG - Intronic
1039629347 8:39091810-39091832 CAGCGGAGTCCTTGGCTCAGAGG + Intronic
1040105319 8:43538235-43538257 GAACTGTGGCTGTGGCTCAGGGG + Intergenic
1041876468 8:62693135-62693157 GAGCTGTGGCTGTGGCTCATTGG + Intronic
1042257730 8:66822906-66822928 GATCTGTGGCCTGGGCACAGTGG - Intronic
1042860712 8:73310448-73310470 GAGCTGTGCTGTTGGAACAGGGG + Intronic
1042926852 8:73975984-73976006 CCGCTCTGTCCTTGGCTCAGCGG - Intronic
1043753577 8:83971875-83971897 CAGCTGTGCCTTAGGCCCAGAGG + Intergenic
1044110301 8:88264703-88264725 GTGCTGTGCCCAAGGCCCAGGGG - Intronic
1046099704 8:109600462-109600484 GCTCTGTGCTCTTGGCTCTGGGG - Intronic
1047616982 8:126570801-126570823 GAGCCCTGCCCTAGGCTCTGTGG + Intergenic
1048243772 8:132770923-132770945 GAGATGTGCATATGGCTCAGGGG - Intergenic
1049271703 8:141699568-141699590 AAGCTGGTGCCTTGGCTCAGTGG - Intergenic
1049414279 8:142488231-142488253 GCGGGGTGCCCATGGCTCAGAGG - Intronic
1052937401 9:34104342-34104364 CAGATGTGCCCTTGTCTCTGTGG - Intronic
1053380991 9:37650018-37650040 GAGTGGTGCCCTTGGCCCCGTGG + Intronic
1054702617 9:68428550-68428572 AAGATGTGATCTTGGCTCAGGGG - Intronic
1054918390 9:70517523-70517545 GTGGTGTGCTCTTGGCTCACTGG + Intergenic
1060068996 9:120530173-120530195 AAGCTGTTCTCTTAGCTCAGTGG + Intronic
1060532025 9:124353357-124353379 GAGCACTGGCCTAGGCTCAGAGG - Intergenic
1061338799 9:129962123-129962145 GAGCTGTGCCCTTTGGTCCAAGG - Intronic
1061368028 9:130182606-130182628 CAGCTGTGCCCTGGCCTCAACGG + Intronic
1062430777 9:136526033-136526055 GGGCTGTGCCCGTCGCTCACTGG - Intronic
1187738731 X:22331739-22331761 GAGCTGTGGCCTTGTCCCACTGG - Intergenic
1188864074 X:35292821-35292843 GAGCTGTGATGTTTGCTCAGTGG + Intergenic
1188963985 X:36528022-36528044 GAGCTGTGATGTTTGCTCAGTGG - Intergenic
1189977569 X:46477995-46478017 GTGGTGTGACCCTGGCTCAGAGG + Intronic
1190781874 X:53604657-53604679 GAGGTGTGGCCTGGGCTGAGAGG + Exonic
1195878263 X:109564730-109564752 GGGCTCTGCCCTGAGCTCAGTGG + Intergenic
1196435573 X:115671430-115671452 GTGGTGTGCTCTTGGCTCACTGG - Intergenic