ID: 1148342048

View in Genome Browser
Species Human (GRCh38)
Location 17:46878996-46879018
Sequence AGTCCCCAGGGGCCCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148342048_1148342060 29 Left 1148342048 17:46878996-46879018 CCCTCTTGGGGCCCCTGGGGACT 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1148342060 17:46879048-46879070 CTTTAAGGGAAATGCTCACAGGG 0: 1
1: 0
2: 0
3: 17
4: 175
1148342048_1148342057 15 Left 1148342048 17:46878996-46879018 CCCTCTTGGGGCCCCTGGGGACT 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1148342057 17:46879034-46879056 CCCTCATTCTACAGCTTTAAGGG 0: 1
1: 0
2: 0
3: 19
4: 238
1148342048_1148342059 28 Left 1148342048 17:46878996-46879018 CCCTCTTGGGGCCCCTGGGGACT 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1148342059 17:46879047-46879069 GCTTTAAGGGAAATGCTCACAGG 0: 1
1: 0
2: 0
3: 12
4: 164
1148342048_1148342055 14 Left 1148342048 17:46878996-46879018 CCCTCTTGGGGCCCCTGGGGACT 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1148342055 17:46879033-46879055 CCCCTCATTCTACAGCTTTAAGG 0: 1
1: 0
2: 0
3: 23
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148342048 Original CRISPR AGTCCCCAGGGGCCCCAAGA GGG (reversed) Intronic
900236498 1:1594136-1594158 TCTCCCCAGGTGCCCCAGGAGGG - Intergenic
900382492 1:2391797-2391819 CGCCTCCAGGGCCCCCAAGATGG - Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900614950 1:3561289-3561311 AGCCCCCTGGGGACCCAAGCTGG + Intronic
900637176 1:3671658-3671680 TGTTCCCAGAGGCCCCGAGAGGG - Intronic
900948610 1:5845058-5845080 AGATCCCAGGGGCCACTAGAGGG + Intergenic
901050871 1:6425313-6425335 AGTCCCCCGGGGCTCAAGGATGG + Intronic
901107927 1:6771816-6771838 AGCTCCCAGGAGGCCCAAGAGGG + Intergenic
903009448 1:20319651-20319673 AGTGCCCGGGGGCCCACAGAAGG - Intronic
903027598 1:20440819-20440841 AGACCCCTTGGGCCCCAGGAGGG - Intergenic
904599233 1:31664690-31664712 TGTCCCCAAGGGCCCAGAGAGGG - Intronic
906294546 1:44641369-44641391 AGCCCCCAGGACCTCCAAGATGG - Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907999693 1:59668277-59668299 AGTCCCCAGGAGACACTAGAGGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
910462771 1:87466572-87466594 AGTCACCAAGGGCCCCGAGGTGG - Intergenic
912996454 1:114536624-114536646 AGTCCACAGCAGCCCCAGGAAGG - Intergenic
913197099 1:116466208-116466230 AAGCCTCAGAGGCCCCAAGAGGG + Intergenic
915312558 1:155011735-155011757 AGTCCCCTGACGCCCCATGAAGG - Intronic
915401139 1:155622702-155622724 AGCCACCAAGGGTCCCAAGAAGG + Intergenic
917121932 1:171652265-171652287 AGGCCCCAGGAGACCCAGGAGGG - Exonic
917898589 1:179517589-179517611 AGTTCGCAGGGTCCCCAAGCAGG - Intronic
920617630 1:207509190-207509212 CCTCCCCAGGGCCCCGAAGAGGG - Intronic
922504791 1:226120324-226120346 AGAACCAAGGGGCCCCAGGAAGG + Intergenic
922603618 1:226875100-226875122 AGGCCCCAGGGGCCCTCTGATGG - Intronic
922674869 1:227543892-227543914 CTTCCCCAGAGGCCCCAGGAAGG - Intergenic
922975679 1:229781611-229781633 AGGCCCCAGGGGCTGCCAGATGG - Intergenic
924178668 1:241419061-241419083 AGTCCCCAGGTGTCCAGAGAAGG - Intergenic
1063283284 10:4655099-4655121 AGTCCCTAGGGAGCCCAAGGAGG + Intergenic
1063975589 10:11413159-11413181 AGTCCCCAGGGTCCCACAGGAGG + Intergenic
1067448291 10:46366531-46366553 AGCCCACAGTGGGCCCAAGAGGG - Intergenic
1067589086 10:47494235-47494257 AGCCCACAGTGGGCCCAAGAGGG + Intergenic
1067636211 10:48002326-48002348 AGCCCACAGTGGGCCCAAGAGGG + Intergenic
1067877276 10:50017997-50018019 AGCCCACAGTGGGCCCAAGAGGG - Intergenic
1069843357 10:71353969-71353991 ACTCCCCAGCTGCCCCAAGGAGG - Intronic
1070258283 10:74828426-74828448 AGTTCTATGGGGCCCCAAGAAGG + Intronic
1070307157 10:75246433-75246455 AGTTCCCAGAGGCCCAGAGAGGG + Intergenic
1070527538 10:77308241-77308263 ACTCCCCAGGTGCCCAGAGATGG + Intronic
1070751275 10:78965360-78965382 CGGCCACAGGGGCCCCAAGCTGG + Intergenic
1072751854 10:97986361-97986383 AGTGCCCATGGGCCCCAGGCTGG - Intronic
1076742611 10:132494244-132494266 CATCCCCAGGGGCTGCAAGATGG + Intergenic
1076747194 10:132520264-132520286 AGTCTCCTGGGGCCCCATCAAGG + Intergenic
1076803622 10:132844332-132844354 ATTGCCCAGTGGCCCCAGGATGG + Intronic
1077171481 11:1168196-1168218 TGACCCAAGGGGCCCCAGGAAGG + Intronic
1077284960 11:1761541-1761563 ATTCCCCAGGGGCCTCCAGGTGG - Intronic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1078147149 11:8729981-8730003 AGTCACCCGGAGACCCAAGAAGG - Exonic
1078736759 11:14027282-14027304 AGACCCCGTGTGCCCCAAGAGGG - Intronic
1079698989 11:23520351-23520373 AGGCCCCAGGGGCCCTGGGATGG + Intergenic
1080852925 11:36086680-36086702 AGTTCCCTGGGGCTCCAAAAGGG + Intronic
1083430415 11:62611372-62611394 AAGCCCCAGAGGCCCCAAGGAGG + Intronic
1083828045 11:65214100-65214122 AGGGCTCAGGGGCCCCAAGCTGG - Intergenic
1084506253 11:69570218-69570240 AAAGCCCAGGGCCCCCAAGAAGG - Intergenic
1084766604 11:71313220-71313242 GGTCTCCAGGTGCACCAAGAAGG - Intergenic
1085310902 11:75516067-75516089 AGTTCCCAGGGCCCCAAACAAGG - Intronic
1085771039 11:79326173-79326195 AGGCCGCGGGGGGCCCAAGAGGG - Intronic
1086985864 11:93248517-93248539 AGTCCCCAAGAGAACCAAGAGGG - Intergenic
1088051964 11:105527416-105527438 AGACACCAGGGCCCACAAGAGGG - Intergenic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1093023067 12:14220774-14220796 AGCCACCAAGGGCCCCAAGAAGG - Intergenic
1094441130 12:30478296-30478318 AGTTCCCAGGGGTACCATGATGG - Intergenic
1094807356 12:34106635-34106657 ATTCCCCAGAGGCCCCAGGAAGG + Intergenic
1095094418 12:38138203-38138225 GGTCCCCAGGGGCAACAGGAGGG - Intergenic
1096865720 12:54561516-54561538 GAGCCCCAGGGCCCCCAAGAGGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1097237169 12:57548516-57548538 GGTCCCCAGGGGCTCCAAGGTGG - Intergenic
1102078624 12:110080171-110080193 AGTCTCCAGGGGACCCTAGTGGG + Intergenic
1102353693 12:112214432-112214454 CATCCCCAGGGGCCAGAAGAGGG + Intronic
1103518918 12:121524891-121524913 GGACCTCAGGGGGCCCAAGAAGG + Intronic
1103717024 12:122950706-122950728 AGCACCCTGGGGCCCCACGATGG - Intronic
1104141795 12:125994507-125994529 CTTCCCCAAGGGCCCCAGGATGG - Intergenic
1104970321 12:132528012-132528034 AGGCCCCAGGGGGACAAAGATGG - Intronic
1110118145 13:71845930-71845952 AGGCCCCATAGGCTCCAAGACGG - Intronic
1115897607 14:38106968-38106990 AGCCACCAAGGGTCCCAAGAAGG - Intergenic
1117216510 14:53557711-53557733 AGTCCCGGTGGGCCCCTAGAGGG + Intergenic
1117789370 14:59323147-59323169 GGTTCCCGGGGGCCACAAGAAGG + Exonic
1120022363 14:79545278-79545300 GTTCCCGAGAGGCCCCAAGAAGG - Intronic
1122174695 14:99908250-99908272 AGTCCCAAGGGGCCCCTCGCAGG - Intronic
1122780688 14:104142224-104142246 AATCCCCTGGGGCTCCAACAGGG - Intronic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1123849710 15:24342536-24342558 ATGCCCCAGGGGCTCCCAGAGGG + Intergenic
1124625057 15:31302965-31302987 AGAGCCCAGGGACCCCACGAGGG - Intergenic
1125519655 15:40340716-40340738 TGTCCCCAGCTGCCCCCAGAGGG + Intronic
1127737275 15:61854430-61854452 AGACCTCAGGGGCTCCAACAGGG - Exonic
1128713993 15:69893708-69893730 AGTCCCCATGGAACCCAAGCAGG + Intergenic
1128757693 15:70194628-70194650 AGGCCCCAGGGGCTCCAGTAGGG - Intergenic
1128984430 15:72208805-72208827 AGTCCACAGCAGCCCCAGGAAGG + Exonic
1129183500 15:73891775-73891797 AGTCCAGAGGGGGGCCAAGAAGG - Intergenic
1129556761 15:76518160-76518182 AGACTCCAGGTGGCCCAAGATGG + Intronic
1130255881 15:82325896-82325918 GGTCCCCAGAGGCCCCAGGGAGG + Intergenic
1131344831 15:91636930-91636952 ACCTCCCAGGGGACCCAAGACGG + Intergenic
1132502917 16:292556-292578 AGGCCCCAGGTGACCCAAGGTGG + Intronic
1132746454 16:1438331-1438353 ACTCCCCATGGCCACCAAGATGG + Intronic
1133001124 16:2852291-2852313 AGGCCTCAGGGGCCTCAGGATGG - Intergenic
1133771630 16:8869817-8869839 TTTCCCCAGTGGCCCCAATAGGG - Intergenic
1134248662 16:12558830-12558852 AGTCACCAAGAGCCACAAGAGGG + Intronic
1136277071 16:29185140-29185162 AGTCCCCAGGCGGCCCCTGAGGG - Intergenic
1137024432 16:35458257-35458279 AGTTCCCAGGGGCCAAAAGAAGG + Intergenic
1138698239 16:58835591-58835613 GGTCCTCAGGGACCCAAAGATGG - Intergenic
1139636565 16:68261718-68261740 ATACACCAGGGGCCACAAGAGGG + Intergenic
1141459321 16:84168126-84168148 TCTCCCCTGGGGCCCCCAGAAGG - Intronic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1141662183 16:85447291-85447313 AGGCCCCAGTGGCCCTGAGAAGG + Intergenic
1142081447 16:88151185-88151207 AGTCCCCAGGCGGCCCCTGAGGG - Intergenic
1142114415 16:88348806-88348828 CAGCCCCAGGGGCCTCAAGAAGG - Intergenic
1142143315 16:88482254-88482276 AGTCCCCACGGACCCCAGGTGGG + Intronic
1142635395 17:1254023-1254045 AGACCCCAGGAGCCCAAAGCTGG + Intergenic
1142960626 17:3550316-3550338 AGTCCACAGGGGCCCAAAGATGG + Intronic
1145250426 17:21294158-21294180 ATTCCCCAGGGTCCCTCAGAGGG - Intronic
1147892492 17:43727161-43727183 AGTCCCCAGGGGCCAGTGGAGGG + Intergenic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1148718192 17:49730755-49730777 AGTGCCCAGGGCTCCCAGGAAGG + Intronic
1148862150 17:50610034-50610056 GGTCCCTGGGGCCCCCAAGAGGG + Intronic
1149435343 17:56629227-56629249 AGTCCTCGGGGGCCAGAAGATGG + Intergenic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150124563 17:62627886-62627908 CGTCCCCAGGGGCGCCGGGACGG - Exonic
1152014913 17:77744280-77744302 AGGCCCCAGGGACCCCATGAGGG - Intergenic
1152722728 17:81930849-81930871 AGCCCCCAGGGGCCCCCTGTAGG + Intergenic
1203170054 17_GL000205v2_random:140446-140468 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1156481535 18:37439600-37439622 GGTCCCCAAGGGCTCCAACATGG - Intronic
1157534684 18:48449570-48449592 AGTCCCCAGAGGCTTCAAGAGGG + Intergenic
1160793893 19:935051-935073 AGTCAACAGGGGCCCCAGTAGGG - Intronic
1160809997 19:1009164-1009186 CGTCCCCAGCGGCCCCGAGGTGG + Exonic
1160847871 19:1174262-1174284 AGTGCGCGGGGCCCCCAAGATGG - Exonic
1160884497 19:1339268-1339290 AGTACCCAGGGCCTCCAGGATGG - Intergenic
1161026563 19:2039897-2039919 AGACCCCAGGGGTCCCCTGAGGG - Intronic
1161359379 19:3838717-3838739 AGGCCACAGGGGCTCCAGGAGGG - Intronic
1161470774 19:4455880-4455902 AGTGCCCAGGGCCTCCAAGGAGG - Intronic
1161946592 19:7441029-7441051 GGATCCCAGGGGCCCCAAGTGGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1163220228 19:15913629-15913651 AGTCCCCAGGAGCCCCATGCTGG + Exonic
1163277456 19:16294282-16294304 AGCCCCCAAGGGCCCTAGGAGGG - Intergenic
1163495976 19:17646865-17646887 TGTCCCCAGTGGCCCCAGGATGG + Intronic
1163545027 19:17936299-17936321 AGGCCACAGAGGCCCCAAGAGGG + Intronic
1163575611 19:18109535-18109557 GGTCCACCGGGGCCTCAAGAGGG + Intronic
1163664705 19:18597910-18597932 TGCCCTCAGGGGCCCCCAGAAGG - Intronic
1164857870 19:31538964-31538986 GGTCCCTAGGGTCCCCCAGAAGG - Intergenic
1165153434 19:33773820-33773842 AGTCCCCAGAGGCCCCTGCAAGG - Intergenic
1165446298 19:35858576-35858598 TGTCCCCTGGGAGCCCAAGAGGG + Intronic
1166283987 19:41812208-41812230 ACTCCCCAGGGCCCTCAGGAGGG - Intergenic
1166385235 19:42376843-42376865 AGTGTCCAGGGGCCCCCAGGTGG - Exonic
1166895243 19:46018497-46018519 AGACCCCAGGGGCAGCAGGAGGG - Exonic
1166975934 19:46605028-46605050 AGTCCCCAGAGTGCCCAAGCTGG + Intronic
925112285 2:1346667-1346689 AGTCTCCTGAGGTCCCAAGAAGG + Intronic
925174405 2:1772049-1772071 ATTCCTCAGGGGCAGCAAGAAGG - Intergenic
925743762 2:7028102-7028124 AGTCCCTGGCGGCCCCAAGGAGG + Intronic
926185051 2:10683767-10683789 TGTCCCCAGGAGACCCAAGAGGG + Intronic
927873736 2:26640610-26640632 ACTCCCCAGGGGCCACAGCAGGG - Intronic
929687089 2:44044467-44044489 AGTTCCCAGGGGCCTCCAGTGGG + Intergenic
930853445 2:55986553-55986575 AGTTCCCAGGAGCCCTAACAAGG + Intergenic
931701503 2:64912995-64913017 AGTCCCTAGCCACCCCAAGAAGG - Intergenic
934750160 2:96788905-96788927 AGTCCACAGGGGCCATGAGAGGG - Intronic
935193025 2:100793483-100793505 AGTCCCCAGGCTCCCCTAGGAGG - Intergenic
938981194 2:136528909-136528931 AATGCCCAGGGTCCCCAAAAGGG + Intergenic
940722001 2:157292565-157292587 AGTCCCCAGTGGCAGCAGGATGG - Intronic
942456706 2:176143059-176143081 AGGCTCCAGTGGTCCCAAGAAGG - Intergenic
943712213 2:191109833-191109855 AGTCTCCAAGGGTCCCATGATGG + Intronic
944888002 2:204084930-204084952 AGTGCCCTGGGGCTCCAAGGAGG + Intergenic
946168532 2:217879845-217879867 GGGACCCAGGGGCCCCAGGATGG + Intronic
946396085 2:219444430-219444452 AGTAACCAGGGGCCCAGAGATGG + Intronic
946438530 2:219675751-219675773 AGTCCCCAGGGGGCTAAACATGG - Intergenic
947503629 2:230690479-230690501 TGTCAGCAGGGCCCCCAAGAAGG - Intergenic
947971526 2:234329057-234329079 AATCCCCAGAGCCCCCAACAGGG + Intergenic
949032164 2:241802372-241802394 AGACCCAAGGGACCCAAAGAAGG - Intronic
1170438359 20:16352803-16352825 AGGCCTGAGGGGCCCCAGGAGGG - Intronic
1171420819 20:25016286-25016308 AGTCCCCAGAGGCCCCCTTATGG - Intronic
1173329490 20:42062575-42062597 AATCCCCAGAGGCCACAGGAGGG - Intergenic
1173386450 20:42592764-42592786 AGTCCTCAGAGGCCTCATGATGG - Intronic
1175348545 20:58301193-58301215 AGACCACAGGGACCCAAAGAAGG + Intergenic
1175746193 20:61459106-61459128 AGGCCCCAGTGGCCCCAGCATGG + Intronic
1176028771 20:63000155-63000177 TGTCCCCAGGGGCCCCGGGTGGG + Intergenic
1176077414 20:63254634-63254656 AGCCCCCAGGGGCCGCAGGCGGG - Intronic
1176100714 20:63363246-63363268 AGTCCCCCGAGGCCCCGTGAGGG + Intronic
1176146988 20:63569854-63569876 CATCCACAGGGGCCCCAGGAGGG - Intronic
1176326049 21:5502242-5502264 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176331658 21:5553941-5553963 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176396099 21:6267010-6267032 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176401708 21:6318709-6318731 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176435449 21:6670395-6670417 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176441058 21:6722094-6722116 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176459711 21:6997465-6997487 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176465320 21:7049163-7049185 AGTCCCCTGTGGCTGCAAGATGG + Intronic
1176483272 21:7379243-7379265 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176488881 21:7430941-7430963 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1177002940 21:15635938-15635960 AGTCCCTATGGGCCCCTAGAGGG - Intergenic
1178631992 21:34269518-34269540 AGTCACCAAAGGCCTCAAGAAGG - Intergenic
1179107523 21:38416311-38416333 TGGCCCCAGTGGCCCCAAAAGGG + Intronic
1179339286 21:40489335-40489357 AGTCAGCAGGGGACCCAGGAAGG - Intronic
1179680609 21:43018591-43018613 ACTCCCCAGGGTCCCCACAAAGG + Intronic
1179928216 21:44550235-44550257 AGCCCCCCGGGGCCCCCAGCTGG + Intronic
1181068189 22:20316403-20316425 AGTCTCCAGGGGACTCCAGAAGG + Intronic
1181899262 22:26139353-26139375 TGTCCCCATGGGCTCCATGATGG + Intergenic
1181931853 22:26408268-26408290 GGTCCCCTGGGGTCCCCAGAGGG - Intergenic
1181985369 22:26796808-26796830 AGTCCCAAAGGGCCCGGAGAGGG - Intergenic
1182084145 22:27550061-27550083 AGACCCCAGGGGCCACTGGAGGG + Intergenic
1183322874 22:37175879-37175901 AGCACCCAGGTGTCCCAAGAGGG + Intergenic
1183490884 22:38115066-38115088 TGTCCCCAAGGGCCTCAGGATGG + Intronic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1184088450 22:42279949-42279971 GCTCCCCAGAGGCCCCCAGAGGG - Intronic
1184455931 22:44609425-44609447 TGTCCCCAGGGGCCCAAGGAAGG - Intergenic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
1185052030 22:48559097-48559119 AGTGCCGAGGGGCCCAAGGAGGG + Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
951950649 3:28196875-28196897 AGTCTACAGGGGACCAAAGAGGG + Intergenic
954130618 3:48558903-48558925 AGGCCACGGTGGCCCCAAGATGG - Intronic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
955404690 3:58618700-58618722 AGGTCACAGGGGGCCCAAGATGG - Intronic
956605755 3:71071390-71071412 AGTCCACAGAGGCCTCAAGCAGG + Intronic
960539971 3:118851351-118851373 AGCCACCAAGGGTCCCAAGAAGG - Intergenic
961812791 3:129531418-129531440 AGTTCCAAGGGGCCACAATATGG - Intronic
962372558 3:134833160-134833182 AGTCCCATGGGACCCCAGGATGG - Intronic
968983182 4:3861586-3861608 GGACCCCAGAGGCCTCAAGAAGG + Intergenic
969232465 4:5841266-5841288 AGGCCCCAGCTGCCCCCAGAAGG + Intronic
969486376 4:7474612-7474634 AGTCCACAGTGTCACCAAGAAGG + Intronic
969486427 4:7474857-7474879 ACTCCCCAGGAGCCCATAGAGGG - Intronic
969495500 4:7523891-7523913 AAGCCCCAGGGGCCCAAGGAGGG - Intronic
969614500 4:8244492-8244514 AGTCTCCAGGGACCCCAACAAGG - Intergenic
972717148 4:41657847-41657869 GGTCCCCAGGAGCCCTAGGAAGG + Intronic
973936770 4:55854028-55854050 AGTCCTCACGGGCCCCATTACGG + Intronic
974003055 4:56530368-56530390 AGTCCCCAGATGCGCCCAGAAGG + Intergenic
977956727 4:103036324-103036346 AGTCCACAGGGACACAAAGAAGG + Intronic
978607815 4:110501473-110501495 AGTACTCATGGACCCCAAGAAGG - Intronic
980137760 4:128876387-128876409 AGTCCCCAGGAGCCAAAGGAAGG + Intronic
984585806 4:181562974-181562996 ACTCCCCAGTGGCCCTAAGAAGG - Intergenic
985025077 4:185732562-185732584 ACTCTGCAGGGGCCCCAGGAGGG - Intronic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
992000824 5:72434614-72434636 GGTCCCCAGGGACCCCATAAGGG + Intergenic
992660092 5:78950774-78950796 AGTGACCAGAGGCCACAAGACGG + Intronic
995269861 5:110207867-110207889 AGTCCCAGTGGGCCCCTAGAGGG - Intergenic
996806043 5:127455054-127455076 TGGCCCCAGGAGCACCAAGAGGG - Intronic
997764319 5:136484653-136484675 AATGCCCAGGTGTCCCAAGAAGG - Intergenic
998168818 5:139860103-139860125 AGTCCCCAAGAGCCCCAAGGAGG + Intronic
1001659960 5:173383894-173383916 ACTCACCAGAAGCCCCAAGATGG - Intergenic
1001716171 5:173818124-173818146 AGTTCCCAGGCTCCCCATGAGGG + Intergenic
1001724574 5:173886354-173886376 TGTCCCCAGTGGCCAGAAGAGGG - Intergenic
1002525647 5:179814529-179814551 AGACCCCAGGGGACCCTTGAAGG - Intronic
1002754813 6:148657-148679 TGCCCCCAGGGGCCAGAAGAGGG - Intergenic
1003324340 6:5081399-5081421 AGTCCCCATGGGCTGCAAGGTGG + Intergenic
1005994985 6:30925589-30925611 GGTGCCCAGGGGCTCCAAGAAGG - Exonic
1006019742 6:31111097-31111119 CGTCTGCAGGGGCCCCTAGAGGG + Intergenic
1006428834 6:33982788-33982810 AGGGCCCTGAGGCCCCAAGAGGG - Intergenic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006717747 6:36130977-36130999 AGTACACCGAGGCCCCAAGAGGG + Intronic
1006792944 6:36715614-36715636 AGTCCCCAGCTGCTCCATGAAGG - Exonic
1007526001 6:42494160-42494182 AGTTCCCAGTGGGCCCAGGATGG - Intergenic
1007788364 6:44295031-44295053 AGTCCCCAAGGACCCACAGAGGG + Intronic
1010900909 6:81426130-81426152 AGTCCCCTTGGCCACCAAGAAGG - Intergenic
1017775177 6:157675106-157675128 GCTCCCCAGAGGCCCCAGGAAGG + Exonic
1018621209 6:165731180-165731202 AGTCTCCAGGAGCCACAAGACGG - Intronic
1019757862 7:2786873-2786895 AGTCCCCAGTCTCCCCATGAAGG - Intronic
1020109418 7:5439772-5439794 GGACCCCAGGAGCCCCAGGAAGG - Intronic
1021624957 7:22583942-22583964 AGTTCCCAGGAGGGCCAAGATGG - Intronic
1022482404 7:30752632-30752654 AGGCCTCTGGGGCCCCCAGAAGG + Intronic
1023037192 7:36142319-36142341 ACTCCCTAGGGGCCCAAGGAAGG - Intergenic
1026792929 7:73346485-73346507 GGGCCCAAGGGGCCCCAGGAGGG + Intronic
1028029153 7:85887349-85887371 AGTCACCAGGAGCTGCAAGAGGG + Intergenic
1029558921 7:101289688-101289710 ATCCCCCAGGAGACCCAAGATGG - Intergenic
1031380264 7:121077038-121077060 AGTCTCCAGGGGCCACCAGGAGG - Intronic
1032192634 7:129773400-129773422 AGTCCCCAGGGCACCCAGGCAGG + Intergenic
1032238033 7:130141359-130141381 AGTGCCCGGGGGTCCCAGGAGGG + Intergenic
1033032775 7:137844020-137844042 TGTCCTCAGGTGCCCCCAGAAGG + Intronic
1034517326 7:151591088-151591110 ATTCCTCAGGGGCTCCAGGAGGG - Intronic
1035441287 7:158903115-158903137 AGTCCCCACGTGCCTCATGAAGG - Intronic
1035564877 8:634937-634959 CTTCCCCAGAGGCACCAAGAGGG - Intronic
1035726273 8:1825622-1825644 AGTGCCCAGGGGCCCATGGAAGG - Intronic
1037843571 8:22262955-22262977 AGGCCCCAGGGGCCCCAGGAGGG - Intergenic
1039417644 8:37409390-37409412 AGTCCACAGGGCCTCCATGATGG + Intergenic
1039792393 8:40886277-40886299 GATCCCCAGGGGCCTGAAGAAGG - Intronic
1047214363 8:122864644-122864666 ACTCCCCAGGGCCCCAGAGAAGG + Intronic
1047542792 8:125786655-125786677 ACTCCCCAGGAGCCAGAAGAAGG - Intergenic
1049459454 8:142717925-142717947 ACTCCCCAGGTGCCCCAGGGCGG + Intergenic
1049640477 8:143712904-143712926 ACTCCCAAGGGGCCCCATGCAGG - Intronic
1053462902 9:38284505-38284527 AGCCCCCAGGGATCCAAAGAAGG - Intergenic
1057030336 9:91770161-91770183 AGTCCCCAGGGCCACCATGAGGG - Intronic
1057634139 9:96747262-96747284 ACTCCCCATTGGCCCCAGGAAGG + Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059388744 9:113985517-113985539 AGTCCCCCTGGCCCCCCAGAGGG - Intronic
1059398842 9:114055940-114055962 GGTACACAGGGTCCCCAAGATGG - Exonic
1059652939 9:116332733-116332755 ATTCCCCACAGACCCCAAGAAGG + Intronic
1060477316 9:123996591-123996613 CGTCCCCAGGGTCCCCAGGGGGG - Intergenic
1060789481 9:126476315-126476337 ACTCCCCAGGGTGCCCCAGAAGG + Intronic
1060802996 9:126556661-126556683 TCTCCCCAGGAGCCCCAGGATGG + Intergenic
1061283342 9:129609607-129609629 CCTCCCCAGGGGCCCCAACAGGG - Intronic
1061352097 9:130073623-130073645 AATTCCCAGGGGCCCAAAAAAGG + Intronic
1062444061 9:136586012-136586034 AGTCCCCAAGGTCCCCAGGGTGG + Intergenic
1203430441 Un_GL000195v1:86393-86415 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1203436079 Un_GL000195v1:138245-138267 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1186801162 X:13093443-13093465 AGACTCCTGGGGCCCCCAGATGG + Intergenic
1189193027 X:39127580-39127602 TGTTCCCAGAGGACCCAAGAGGG - Intergenic
1192043201 X:67644728-67644750 AGTCCTCAGGGCCTACAAGAAGG + Intronic
1197706172 X:129636234-129636256 AGTCCCCAGGGCCGCCATAAGGG + Intergenic
1198308226 X:135403463-135403485 ACTTCACAGGGGCCACAAGAAGG - Intergenic
1198508222 X:137322848-137322870 AATCAGCAGGGGCACCAAGATGG - Intergenic
1199655405 X:149990162-149990184 AGTCTCCAGGGGCCCAGAGCAGG - Intergenic
1200119729 X:153784607-153784629 GGTCCCCAGGTCCTCCAAGAGGG - Intronic
1201471619 Y:14341353-14341375 AGCCACCAAGGGTCCCAAGAAGG + Intergenic
1201770782 Y:17615077-17615099 AGTCCCCTGTGGCCACAAGATGG - Intergenic
1201830773 Y:18290909-18290931 AGTCCCCTGTGGCCACAAGATGG + Intergenic