ID: 1148343938

View in Genome Browser
Species Human (GRCh38)
Location 17:46890900-46890922
Sequence GGATGAGGCGGGCAAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148343938_1148343943 6 Left 1148343938 17:46890900-46890922 CCAGGACTTTGCCCGCCTCATCC No data
Right 1148343943 17:46890929-46890951 ATTTCCATTAACAGCCCCTGAGG No data
1148343938_1148343945 10 Left 1148343938 17:46890900-46890922 CCAGGACTTTGCCCGCCTCATCC No data
Right 1148343945 17:46890933-46890955 CCATTAACAGCCCCTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148343938 Original CRISPR GGATGAGGCGGGCAAAGTCC TGG (reversed) Intergenic
No off target data available for this crispr