ID: 1148344919

View in Genome Browser
Species Human (GRCh38)
Location 17:46896857-46896879
Sequence CTAGATGCCCTCAGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148344919_1148344925 5 Left 1148344919 17:46896857-46896879 CCTGGGACCCTGAGGGCATCTAG No data
Right 1148344925 17:46896885-46896907 GACACCCCCCACCAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148344919 Original CRISPR CTAGATGCCCTCAGGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr