ID: 1148351345

View in Genome Browser
Species Human (GRCh38)
Location 17:46944011-46944033
Sequence GGCCAGTGGAACCACACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148351345_1148351351 3 Left 1148351345 17:46944011-46944033 CCATTAGTGTGGTTCCACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148351351 17:46944037-46944059 CCTTCCAGGCATCTGTGACATGG 0: 1
1: 0
2: 3
3: 21
4: 228
1148351345_1148351352 6 Left 1148351345 17:46944011-46944033 CCATTAGTGTGGTTCCACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148351352 17:46944040-46944062 TCCAGGCATCTGTGACATGGTGG 0: 1
1: 0
2: 1
3: 16
4: 257
1148351345_1148351355 21 Left 1148351345 17:46944011-46944033 CCATTAGTGTGGTTCCACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148351355 17:46944055-46944077 CATGGTGGCTCCTGGAGAGCTGG 0: 1
1: 0
2: 3
3: 57
4: 348
1148351345_1148351356 27 Left 1148351345 17:46944011-46944033 CCATTAGTGTGGTTCCACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148351356 17:46944061-46944083 GGCTCCTGGAGAGCTGGCAGAGG 0: 1
1: 0
2: 4
3: 52
4: 460
1148351345_1148351354 13 Left 1148351345 17:46944011-46944033 CCATTAGTGTGGTTCCACTGGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148351354 17:46944047-46944069 ATCTGTGACATGGTGGCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148351345 Original CRISPR GGCCAGTGGAACCACACTAA TGG (reversed) Intronic
901908757 1:12437287-12437309 GCCCAGAGGAAACAAACTAAGGG + Intronic
902174504 1:14639101-14639123 GGCAGGTGGAGCCACACCAAGGG - Intronic
902297922 1:15481122-15481144 GGCCAGTGGTACCACACCTGCGG + Exonic
904351918 1:29913941-29913963 GGCCAGTGGAACCTCAGACATGG - Intergenic
906319327 1:44806678-44806700 GGCTGGAGGAACCACACTCAGGG + Intergenic
906651803 1:47518053-47518075 GGCCAGTGGAGCAACACTGAGGG - Intergenic
916719968 1:167477430-167477452 GGGCACTGGAACTACACAAATGG - Intronic
920963844 1:210686169-210686191 GGCCAGAGAAACCCAACTAAAGG + Intronic
1064618892 10:17193877-17193899 GGCCAGAGGTATCACATTAATGG + Intronic
1065811896 10:29450362-29450384 GGCCAGGGGAACCCGGCTAAGGG - Intergenic
1073904348 10:108260446-108260468 GGTCTGTGGAAGCACAGTAATGG + Intergenic
1074794400 10:116926853-116926875 GGCATGTGGAACCACAAAAAAGG + Intronic
1083315933 11:61815187-61815209 GGCCGGTGGCACCACACATACGG + Intronic
1089093391 11:115897511-115897533 AGTCAGTGGAACCACCCAAAAGG + Intergenic
1091431037 12:434820-434842 GGCCACTGGAACCAGGCAAAAGG - Intronic
1102180492 12:110909085-110909107 GGCCAGAGGAGCCACAGTTAGGG - Intergenic
1116160320 14:41259514-41259536 GGCCAGTGGAATGAAACTGAAGG + Intergenic
1121892205 14:97604820-97604842 TCTCAGTGAAACCACACTAAGGG - Intergenic
1126811825 15:52414192-52414214 GGCAAGTGGACACACACAAACGG - Intronic
1127942391 15:63712300-63712322 GGACATTGGAGACACACTAACGG + Intronic
1130240973 15:82190666-82190688 GGCAAGTAGAATCACAATAAGGG + Intronic
1139782229 16:69361457-69361479 GGCAAGTGGAACAGCTCTAATGG - Exonic
1140480034 16:75257355-75257377 GGCCAGTGGAATCACAAGAGGGG + Intronic
1144582207 17:16465377-16465399 GGGCAGATGAACCACACTAGTGG + Intronic
1146354216 17:32120403-32120425 GAGCAGTGGAACCAGGCTAAGGG - Intergenic
1148351345 17:46944011-46944033 GGCCAGTGGAACCACACTAATGG - Intronic
1148607448 17:48940925-48940947 GGCCAGCGGATCCACGCCAATGG + Exonic
1153618142 18:6952778-6952800 GTCCAGTGGATCCACACCATGGG + Intronic
1153618173 18:6952934-6952956 GTCCAGTGGATCCACACCATGGG + Intronic
1153618205 18:6953090-6953112 GTCCAGTGGATCCACACCATAGG + Intronic
1154172242 18:12060660-12060682 TGCCAGTGTAACCACAATAGTGG - Intergenic
1157408341 18:47442566-47442588 TGCCAGTGGAACAACTCCAAGGG + Intergenic
1160312741 18:77811184-77811206 TGCCAGTGGAAAGACACAAAGGG - Intergenic
1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG + Intronic
1164965730 19:32481021-32481043 GGCCTGTGGAAACACACCAGTGG - Intronic
931260306 2:60612315-60612337 AGCAAGAGAAACCACACTAAAGG + Intergenic
932327349 2:70871886-70871908 GGCCCTTGGTACCACACTGATGG - Intergenic
936134368 2:109876798-109876820 TACCATTGGAACCACACTAGGGG + Intergenic
936152635 2:110030076-110030098 GGCCAGAGGCACCACAGAAATGG + Intergenic
936192045 2:110341336-110341358 GGCCAGAGGCACCACAGAAATGG - Intergenic
936210329 2:110494687-110494709 TACCATTGGAACCACACTAGGGG - Intergenic
936434917 2:112496080-112496102 TACCATTGGAACCACACTAGGGG - Intronic
938103339 2:128513009-128513031 GGGCAGTGGAGCCACACTCAGGG + Intergenic
940291692 2:152083494-152083516 GGCCACTGCTACCACAATAACGG + Intronic
940910009 2:159202175-159202197 GCCCAGTGCCACCACACTGACGG - Intronic
941659765 2:168183774-168183796 GGCCAGTGAAGCCAAACTAGTGG - Intronic
942169639 2:173277253-173277275 GGGTAGTGGAATCACATTAATGG - Intergenic
945949056 2:216021549-216021571 GGCCTATGGAACAACATTAAAGG - Intronic
947861705 2:233364282-233364304 TGCCAGCAGACCCACACTAAAGG + Intronic
1170430076 20:16267694-16267716 GGCCAGTGGAGCCACAAGAATGG + Intergenic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1172781579 20:37439732-37439754 TGCCAGGGCAACCACACGAATGG - Intergenic
1179631537 21:42681683-42681705 TGCCAGTCAAACCACACAAAAGG + Intronic
1182148219 22:28010607-28010629 GGCCAGTGAAACCATGCTCAGGG + Intronic
1184297705 22:43535765-43535787 GGCCAGTGGAAGCAGACTGCAGG + Intronic
950455541 3:13090748-13090770 GGCCTGAGGAGGCACACTAAGGG + Intergenic
951578462 3:24137543-24137565 GGCCAGAGGAAGAACACTCAAGG + Intronic
956137200 3:66111046-66111068 GGCCAGTGGGAACAAACCAACGG - Intergenic
960643903 3:119856635-119856657 GGCCAGTGGAGACACACCACAGG - Intronic
963055199 3:141180873-141180895 AGCCAGTGGAATCATACGAAAGG - Intergenic
963322808 3:143827852-143827874 ACCCAGTGGGGCCACACTAATGG + Intronic
966673501 3:182558824-182558846 TGCCAGTGTAGCCACACTAGGGG - Intergenic
968183217 3:196612584-196612606 GGCCAGTGGAAGAACACTGGAGG - Intergenic
968591637 4:1462606-1462628 GCCCAGAGGAGCCACACTCAGGG + Intergenic
969912107 4:10456898-10456920 GGCCAGCGGCGCCACACGAACGG + Intronic
984600689 4:181722944-181722966 GGACAGTGGAACCACTCTCAGGG + Intergenic
986151898 5:5137469-5137491 GGACACTGGAACCAAACAAAGGG + Intergenic
990481482 5:56215455-56215477 GCCCAGTGGAGCCACAGTGATGG + Intronic
990906590 5:60810107-60810129 GGCCAGTGGAACTTCACTTGAGG + Intronic
991130534 5:63117788-63117810 GGACAGTAGGACCTCACTAAGGG - Intergenic
992709963 5:79442470-79442492 GGTCACTGAAACCACCCTAAAGG - Intronic
999400055 5:151257600-151257622 GGGCAGTGGAACCCCACTGAAGG - Intronic
1001415725 5:171543778-171543800 GGCCTGTGGAAACACAGCAAAGG + Intergenic
1002254738 5:177950783-177950805 GGACAATGGAAAAACACTAATGG - Intergenic
1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG + Intronic
1005977462 6:30811014-30811036 TGCCTGTGAAACCACAATAAAGG + Intergenic
1019101492 6:169634370-169634392 TGCCAGAGGAACAACACTCAGGG + Intronic
1022519792 7:30998766-30998788 GCCCAGAGGAAACACACTAGAGG - Intergenic
1024930591 7:54663993-54664015 GGGCAGCGGGAACACACTAAAGG + Intergenic
1028936156 7:96466205-96466227 GGGTAGTGGAAATACACTAAAGG - Intergenic
1030405268 7:109102803-109102825 AGCCATTGCAACTACACTAATGG + Intergenic
1031920058 7:127593785-127593807 GGCCTGTGGAACCTCACCACGGG + Exonic
1039543095 8:38387175-38387197 AACCTGTGGACCCACACTAACGG - Intronic
1039750162 8:40471344-40471366 GGCCTGAGGAACCACACTGCTGG + Intergenic
1041092913 8:54319304-54319326 GGACAGTGGAAGCACAGAAATGG + Intergenic
1042988617 8:74613016-74613038 AGACAGTGAAACCTCACTAAAGG + Intronic
1048008632 8:130439070-130439092 GCCCAGTGGAATCACTTTAAGGG + Intronic
1057245670 9:93452120-93452142 GGCCAGTGGAACCACATGCTTGG + Exonic
1193245228 X:79220636-79220658 GGGCAGTGTAACAACAGTAAGGG + Intergenic
1202379608 Y:24263662-24263684 GGCAAGTAGAATCACAATAAGGG + Intergenic
1202491174 Y:25406459-25406481 GGCAAGTAGAATCACAATAAGGG - Intergenic