ID: 1148354797

View in Genome Browser
Species Human (GRCh38)
Location 17:46968685-46968707
Sequence TGGTGGGGAAGGCAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 1, 1: 0, 2: 10, 3: 99, 4: 1065}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148354797_1148354807 9 Left 1148354797 17:46968685-46968707 CCCTCTGCCTGCCTTCCCCACCA 0: 1
1: 0
2: 10
3: 99
4: 1065
Right 1148354807 17:46968717-46968739 CAATGGCCATGCAGATCTTCAGG 0: 1
1: 0
2: 3
3: 22
4: 202
1148354797_1148354809 27 Left 1148354797 17:46968685-46968707 CCCTCTGCCTGCCTTCCCCACCA 0: 1
1: 0
2: 10
3: 99
4: 1065
Right 1148354809 17:46968735-46968757 TCAGGACACAAACAGAAAGCAGG 0: 1
1: 1
2: 2
3: 43
4: 319
1148354797_1148354810 28 Left 1148354797 17:46968685-46968707 CCCTCTGCCTGCCTTCCCCACCA 0: 1
1: 0
2: 10
3: 99
4: 1065
Right 1148354810 17:46968736-46968758 CAGGACACAAACAGAAAGCAGGG 0: 1
1: 1
2: 11
3: 43
4: 450
1148354797_1148354811 29 Left 1148354797 17:46968685-46968707 CCCTCTGCCTGCCTTCCCCACCA 0: 1
1: 0
2: 10
3: 99
4: 1065
Right 1148354811 17:46968737-46968759 AGGACACAAACAGAAAGCAGGGG 0: 1
1: 1
2: 10
3: 67
4: 633
1148354797_1148354802 -8 Left 1148354797 17:46968685-46968707 CCCTCTGCCTGCCTTCCCCACCA 0: 1
1: 0
2: 10
3: 99
4: 1065
Right 1148354802 17:46968700-46968722 CCCCACCAGCACCTCTACAATGG 0: 1
1: 0
2: 1
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148354797 Original CRISPR TGGTGGGGAAGGCAGGCAGA GGG (reversed) Intronic
900398262 1:2462164-2462186 TGGAGGGGGTGTCAGGCAGAGGG - Intronic
900420270 1:2553205-2553227 AGGTGGGGAAAGCAGACAGACGG + Intergenic
900424158 1:2568453-2568475 AGGTGGGGAAAGCAGACGGACGG - Intergenic
900512358 1:3066709-3066731 TGGAGGAGGAGGCAGGGAGAGGG + Intergenic
900641771 1:3691026-3691048 AGGCCAGGAAGGCAGGCAGAAGG - Intronic
900874380 1:5331145-5331167 TGGTGGGCATGGCAGGGTGAGGG + Intergenic
900896611 1:5487223-5487245 TGGTGGTGCAGGCAGGGTGAGGG - Intergenic
901027494 1:6286315-6286337 TTCTGGGGAAGGCGGCCAGAAGG + Intronic
901045243 1:6392438-6392460 AGGTGGGGAGGGCAGCCTGAAGG - Intronic
901101321 1:6721299-6721321 GGGTGGCCAAGGCAGGCGGATGG - Intergenic
901316790 1:8315123-8315145 TGTGGGGGAAGGATGGCAGAGGG - Intergenic
901343558 1:8517940-8517962 AGGTGGCGATGGCAGGCAAAGGG + Intronic
901404312 1:9036079-9036101 TGGTGGGGGAGGAAGGGAAAAGG - Exonic
901560770 1:10068588-10068610 GGGAGGCCAAGGCAGGCAGATGG - Intronic
901638354 1:10680670-10680692 TGAAGGGGCAGGCGGGCAGACGG + Intronic
901763830 1:11487725-11487747 GGGTGGGGCAGGCAGTGAGAGGG - Intronic
901769917 1:11524848-11524870 TGGTGGGGGAGATAGGCACAGGG - Intronic
902376327 1:16031696-16031718 TGGTGGGAGCTGCAGGCAGAGGG - Exonic
902381290 1:16053625-16053647 CGGTGGGAACTGCAGGCAGAGGG - Exonic
902437075 1:16405178-16405200 TGGTGGAGGAGGCTGGCAGGAGG - Intronic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902574515 1:17368968-17368990 TGGTGGGAAAGGGAGGGACATGG + Intergenic
902688126 1:18092190-18092212 TCATGGGCAAGGCAGGCAGCGGG - Intergenic
902751192 1:18512310-18512332 TGATGGGGAAAGGAGGAAGATGG + Intergenic
903175148 1:21576110-21576132 TGGTCGGGTAGACAGGCAGGTGG + Intronic
903269981 1:22181932-22181954 TGGCTGGGAAGACAGGCAGGGGG - Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903323569 1:22556541-22556563 TGGTGGGGAGGAGAGGCTGAAGG + Intergenic
903635290 1:24809796-24809818 TGGTCAGGAAGGAAGGAAGAAGG + Intronic
903946577 1:26967797-26967819 TGGCGGGGCAGGGAGCCAGAGGG - Intergenic
904013927 1:27406120-27406142 TAGTTGGAGAGGCAGGCAGAGGG - Exonic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904594848 1:31637140-31637162 TTGTGGGGAGGGCAGGAAGCAGG + Intronic
905252468 1:36658528-36658550 TGCTGGGGAGGGCAGGGAGAGGG + Intergenic
905489405 1:38331906-38331928 TGGAGGGGAAGGGAGGGAGATGG - Intergenic
905662349 1:39737309-39737331 AGGTGGGAAAGGTAGGCAGAGGG - Intronic
905820688 1:40988151-40988173 GGGAGGCCAAGGCAGGCAGATGG - Intronic
905852269 1:41283063-41283085 TGGTGGCCAGGGCAGCCAGAGGG - Intergenic
905905478 1:41615390-41615412 TGATGGGGAAGCCAGGCTGAGGG - Intronic
906409637 1:45568355-45568377 TGGTGAGAAAAGCAGGCTGAAGG + Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906491130 1:46269653-46269675 TGGTGGGTATGGCAGGCAGTAGG - Intronic
906552926 1:46681196-46681218 GGGAGGCCAAGGCAGGCAGATGG - Intronic
906686379 1:47765946-47765968 TGGTGGCGATGGCGGGGAGAAGG + Exonic
907200479 1:52722473-52722495 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
907250599 1:53135818-53135840 TTGTGGGCGAGGCAGGCAAATGG + Intronic
907357289 1:53886666-53886688 TGGTGGGGAAAGCTGACACAAGG - Intronic
907560003 1:55379555-55379577 TGGTGAGGAAGGAGGGCAAAGGG - Intergenic
907572057 1:55492479-55492501 TGCTGGGGAAGGAAGGTGGAAGG + Intergenic
907897995 1:58710824-58710846 TGGTAGGGATGTCAGGCAGAGGG - Intergenic
908489951 1:64633504-64633526 TTGTTGGGAAGTCAGGAAGAAGG + Intronic
908558994 1:65286071-65286093 TGCTGGGGCAGGGAGGTAGAGGG - Intronic
909334160 1:74451241-74451263 TGTTGGGGAAGGCAGGGGGAGGG + Intronic
909352094 1:74665851-74665873 GGGAGGGGGAGGCAGACAGAAGG + Intronic
910846962 1:91613055-91613077 GGGAGCGGAAGGCAGGCGGATGG + Intergenic
910939526 1:92518135-92518157 GGGAGGCCAAGGCAGGCAGATGG - Intronic
911086870 1:93985787-93985809 TGTTGGGGAAGGTAGGCAGGAGG + Intergenic
911489166 1:98541141-98541163 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
912334143 1:108846866-108846888 GGGTGTGGAAGGCAAGCAGGAGG - Intronic
912449577 1:109760838-109760860 TGGTGGGGAGAGCAGGCAGAGGG - Intronic
912513214 1:110202148-110202170 TGGTGGGGGAGAGAGGAAGAGGG - Exonic
912690958 1:111804356-111804378 GTGTGGGGAAGGCTGACAGATGG - Intronic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
912776837 1:112510724-112510746 TGTTGGGGAAGGCAAGGAGGGGG + Intronic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
913191537 1:116417420-116417442 AGGAGGCCAAGGCAGGCAGATGG - Intergenic
913349640 1:117843031-117843053 TGTTGGGGAAGACGGCCAGAGGG - Intergenic
913384211 1:118241881-118241903 TGGAGTGGAAGGTGGGCAGAGGG - Intergenic
913399815 1:118419025-118419047 TGGTGGAGAAGGCAGGGAGTAGG + Intergenic
913957680 1:143319577-143319599 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
914051990 1:144144941-144144963 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
914127207 1:144821600-144821622 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915030816 1:152879165-152879187 TGGTTGGGAAGGAAGGGAAATGG + Intronic
915162489 1:153930247-153930269 GGGTGGGGAAGTGAGGAAGAAGG - Exonic
915302088 1:154957481-154957503 GGGTGGGGAAGGCAGGCATGGGG - Exonic
915431819 1:155872599-155872621 TTGGGGGGCAGGCAAGCAGAAGG - Intronic
915441012 1:155945531-155945553 AGGTGGGGAAGGAAGGTAGGTGG - Intergenic
915582183 1:156820484-156820506 GGGAGGCCAAGGCAGGCAGATGG - Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915951396 1:160191996-160192018 GGGTGGGGAAGGGAGGCGGTTGG - Intronic
916005435 1:160655103-160655125 TGCTGGGGCAGGCACGTAGATGG - Intergenic
916034782 1:160912216-160912238 GGGTACAGAAGGCAGGCAGAGGG - Intergenic
916144542 1:161727138-161727160 GGATGGGGAAGGCCGGAAGAGGG - Intronic
916336219 1:163673680-163673702 TGATGGGGGTGGCAGGGAGAGGG + Intergenic
916730605 1:167563470-167563492 GGGTGAGGAAGGCAAGCATATGG + Intergenic
916786110 1:168088247-168088269 AGGTGGGCAGAGCAGGCAGAGGG + Intronic
916850084 1:168694915-168694937 TGATGGGGAAGGCAGGGCTAAGG - Intergenic
917222582 1:172747892-172747914 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
917300764 1:173571435-173571457 AGGTGAGGGAGCCAGGCAGATGG - Intronic
917337083 1:173935865-173935887 TGGTTGGGCAGAAAGGCAGAAGG - Exonic
917598533 1:176553239-176553261 CGGTGGGTAAGGCAGGGAGGGGG + Intronic
917632864 1:176906879-176906901 TGGTGGGGGAGGTAGGCTAAAGG + Intronic
917797277 1:178541613-178541635 TGGTGGGAGAGGCGTGCAGAAGG - Intronic
918184702 1:182116422-182116444 TGGTGGTGCACCCAGGCAGAAGG + Intergenic
919071740 1:192764449-192764471 TGGTGAGGAAGGAATGGAGATGG - Intergenic
919733910 1:200932604-200932626 TGGTGGAGATGGAAGCCAGATGG - Intergenic
919820600 1:201469437-201469459 TGGCGGGGAAGGGAGGGGGAAGG + Intergenic
919862540 1:201750377-201750399 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
919919505 1:202159905-202159927 TGGTTGGGCAGCCAGGCAGGCGG + Intronic
920104572 1:203542698-203542720 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
920154271 1:203935663-203935685 AGGAGGGGAAGTCATGCAGAGGG + Intergenic
920203384 1:204274615-204274637 GGGAGGGGAAGGAAAGCAGAAGG - Intronic
920431183 1:205920241-205920263 TGTTGGGGTAGGGAGGCAAAAGG + Intronic
920554598 1:206895514-206895536 AGGCGGGGAGGGCAGGCAGGTGG - Intergenic
920947355 1:210542216-210542238 AGGTGGGAGAGGCAGGCAGATGG - Intronic
921051949 1:211517220-211517242 TGGTGGAGGAAGCAGGAAGAAGG + Intergenic
921213164 1:212916794-212916816 TGGTGGGGAAGGAACACAGATGG + Intergenic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
921517387 1:216112605-216112627 TGAGGGTGAAGGGAGGCAGAAGG - Intronic
921557286 1:216614025-216614047 GGGTGTGGAAGTCAGGGAGAAGG - Intronic
921694379 1:218190777-218190799 TTTTGGGGAAGGGAGGAAGATGG + Intergenic
922594759 1:226805066-226805088 AGGTGTTTAAGGCAGGCAGATGG + Intergenic
922701918 1:227766161-227766183 TGATGGGGCAGGCAGGCAGGTGG - Intronic
922929490 1:229377593-229377615 TGGTTGGCCAGGCGGGCAGAGGG - Intergenic
923109526 1:230879801-230879823 AGGAGGGGGAGGCCGGCAGAGGG - Intergenic
923109539 1:230879838-230879860 TGGAGGGGGAGGCCGGCAGAGGG - Intergenic
923109574 1:230879951-230879973 AGGAGGGGGAGGCTGGCAGAGGG - Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923268513 1:232334733-232334755 GGGAGGGGAAGGGAGGAAGATGG - Intergenic
923501934 1:234572309-234572331 TTGGTGGGAAGGCAGGGAGAAGG - Intergenic
923779587 1:237010279-237010301 TGTTGGGGAAGGCAGACATTAGG - Intergenic
924329091 1:242924458-242924480 TGGTGAGGGAGGAAGGCAGTGGG + Intergenic
924508511 1:244709293-244709315 TTCTGGGGAATGGAGGCAGAGGG + Intergenic
1062894307 10:1091142-1091164 GGGTAGGGCAGGCAGGCACATGG - Intronic
1063462665 10:6224335-6224357 TGCTGAGGAAGGCAGCCAGCAGG - Intronic
1064116732 10:12584578-12584600 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1064250816 10:13705146-13705168 TGGCGGGGAAGGAAGGAAGTCGG - Intronic
1065205129 10:23349920-23349942 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1065233469 10:23622403-23622425 AGGTGGGGAAGGTAGGCAGAGGG - Intergenic
1065289205 10:24213389-24213411 CAGTGGGGAAGGCAAGCAGGTGG - Intronic
1066183968 10:32990866-32990888 AGGTGTGGTAGTCAGGCAGATGG - Intronic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1066759992 10:38741006-38741028 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1066961625 10:42231762-42231784 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1067188751 10:44052569-44052591 TGGTGTGGGAGGCATCCAGAAGG + Intergenic
1067304707 10:45050936-45050958 GGGTGGAGAGGGTAGGCAGAGGG + Intergenic
1067437962 10:46292176-46292198 TCTTCTGGAAGGCAGGCAGAGGG + Intronic
1068870239 10:61935557-61935579 TGGTGGGGAGTGGAGGGAGAGGG + Intronic
1069617137 10:69813469-69813491 TGGTGAGACAGGGAGGCAGAGGG + Intronic
1069640528 10:69952649-69952671 GGGAGGGGAGGACAGGCAGAGGG - Intronic
1069709100 10:70478042-70478064 TGGTGGGGGGGGCAGGCCTATGG + Intergenic
1069716874 10:70526738-70526760 TGCTGGGGAGGACAGGAAGATGG + Intronic
1069821337 10:71230541-71230563 AGGTGGGGAGGGCAGAGAGAAGG - Intronic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070405243 10:76088542-76088564 TGGATGGGAAGCCAGGCAGGAGG + Intronic
1071144231 10:82548843-82548865 TGGTCTGGAATCCAGGCAGAAGG + Intronic
1071567960 10:86681253-86681275 TGGAGGAGCAGGCAGGCACATGG - Intronic
1072621718 10:97084102-97084124 TTCTGGGGGAGACAGGCAGAGGG + Intronic
1072720852 10:97780269-97780291 TGCTGGGGAAGGCAGCCCTAGGG + Intergenic
1072863414 10:99030995-99031017 AGGTGGTGAGGGCAGGAAGAAGG + Intronic
1072939517 10:99747758-99747780 GGGAGGGCAAGGAAGGCAGATGG - Intronic
1073095998 10:100980060-100980082 TTGTGGAGAGGGCAGGCAGGTGG + Intronic
1073453041 10:103620574-103620596 TGGTCGGGGAGGCAGGCTGCAGG - Intronic
1073461188 10:103666885-103666907 GGGTGGGGAAGGGAGGCCGGGGG + Intronic
1073500590 10:103933320-103933342 TGGTTGGGAGGGGAGGGAGACGG + Intergenic
1074086823 10:110214611-110214633 GGGTGGGGTAGGGAGGCAGGGGG - Intronic
1074253777 10:111780093-111780115 TAGAAGGGAATGCAGGCAGATGG + Intergenic
1074434684 10:113424095-113424117 TGCTGGGGAAGGCTGGCCAATGG + Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075392267 10:122100883-122100905 GGAGGGGCAAGGCAGGCAGAGGG - Intronic
1075433478 10:122411277-122411299 AGGTGGAGAAGGAAGGGAGAGGG + Intronic
1075521905 10:123148284-123148306 TGGTGCAGCAGGCAGGCAGTGGG - Exonic
1075567533 10:123515483-123515505 TGCTGGGAAATGCAGGCAGTGGG - Intergenic
1075737522 10:124673183-124673205 AGGTGGGGAGGCCAGGCAGGAGG - Intronic
1075788151 10:125064129-125064151 TGGTGTGGAAGACAGTTAGATGG + Intronic
1076130549 10:128010929-128010951 TTAAGCGGAAGGCAGGCAGAAGG + Intronic
1076188154 10:128464617-128464639 AGGAGGGGAAGGCAGGAGGATGG - Intergenic
1076347758 10:129791759-129791781 TGGTGGGGAGTGGAGGAAGAGGG - Intergenic
1076528299 10:131126625-131126647 TGCTGGGGAAGCCTGGCAGCCGG - Intronic
1076566685 10:131404006-131404028 TGGTGGGGGAGGCTGGCATGGGG + Intergenic
1076791879 10:132781004-132781026 TGCTGGGGCTGGCAGGCAGGTGG + Intronic
1076801771 10:132834345-132834367 GGGGTGGGAAGGAAGGCAGAGGG - Intronic
1076805883 10:132858522-132858544 TGGTGGGGACGGCTGGCATCAGG + Intronic
1076840748 10:133043992-133044014 TGGTGGGTGGGGCAGGCATAAGG - Intergenic
1076981725 11:208398-208420 TGCTGGGGAATGCAGGCGAACGG - Intronic
1077015946 11:399295-399317 AGGTGGAGAAGGGGGGCAGATGG - Intronic
1077037375 11:502007-502029 TGGTGGGGCAGGCTGGCGGGTGG - Intronic
1077159855 11:1107766-1107788 TGGTGGGCAGGGCAGGGAGGAGG + Intergenic
1077342390 11:2031917-2031939 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1077544731 11:3164494-3164516 GGGTGGGGCAGGCAGGAAGGAGG - Intronic
1077723175 11:4647464-4647486 TGGAGAGGAAGCCAGCCAGAGGG - Intronic
1078055197 11:8003560-8003582 TGGTAGGGTGGGCAGGCAGCTGG - Intergenic
1078355753 11:10630259-10630281 TGTTGGGGGAGGGAGGAAGAGGG - Intronic
1078375208 11:10787635-10787657 TGGTAGGGAGGGGAGGCAGGAGG - Intergenic
1078509696 11:11976246-11976268 TGGAGGGGAAGACAAGAAGAAGG + Intronic
1079542976 11:21598126-21598148 TGGAGGAGAAGGCTGGGAGAGGG + Intergenic
1080190851 11:29546911-29546933 AAGTGGGGATGGCAGGCAGGTGG - Intergenic
1080521180 11:33068864-33068886 GTTTGGGGAAGGCAGGCAGCAGG + Intronic
1080622979 11:34002750-34002772 GGGTGGGGGGTGCAGGCAGAAGG + Intergenic
1080637008 11:34133082-34133104 TGGGGGGCACGGGAGGCAGAAGG - Exonic
1081084136 11:38778053-38778075 TGGAGAGGAGGGCAGGAAGAGGG + Intergenic
1081292937 11:41349094-41349116 TGCTGGGAAAAGCTGGCAGATGG - Intronic
1081650192 11:44818603-44818625 GGATAGGGCAGGCAGGCAGAGGG - Intronic
1081732709 11:45382832-45382854 GGTGGGGGCAGGCAGGCAGAAGG - Intergenic
1081911045 11:46700316-46700338 CCCTGGGGAAGGCAGGAAGAAGG + Intronic
1082888678 11:58114858-58114880 TGGTGGTGAAGGCAGTCAGGAGG + Intronic
1083087501 11:60165380-60165402 CGATGGGGAAGGGAGGGAGAGGG + Intergenic
1083319200 11:61834967-61834989 TGGGGGGGCAGGCAGGGAGGAGG - Intronic
1083429900 11:62608923-62608945 TGGTGGGCTTGGCAGGAAGAGGG - Intronic
1083861645 11:65423202-65423224 TGATCAGGAAGGCAGGCAGTGGG + Intergenic
1083863253 11:65437776-65437798 TGATGGGGTAGTCAGTCAGATGG - Intergenic
1083872282 11:65496422-65496444 TGGAGAGGAAGGGAGGCAGCAGG + Intergenic
1084239717 11:67810658-67810680 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1084565079 11:69924042-69924064 TGGTGTGGACAGCAGGCAGCTGG + Intergenic
1084579303 11:70012943-70012965 TAGTGGGGAAGGCAGACAATAGG + Intergenic
1084832716 11:71782186-71782208 GGGAGGCCAAGGCAGGCAGACGG + Intergenic
1084978700 11:72816975-72816997 TGGTGGGGGAGGCAGGCCCTTGG + Intronic
1084989425 11:72909398-72909420 TGGAGGCCAAGGCAGGCAGCTGG - Intronic
1085034656 11:73292716-73292738 TGTTGGGGATGGCAGGGAGCCGG + Intronic
1085039443 11:73318198-73318220 TGGTGGGGAAAGCACGTAGCGGG - Intronic
1085071816 11:73553740-73553762 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1085335319 11:75688761-75688783 TGGTAAGGAAGGAAGGAAGACGG - Intergenic
1085440251 11:76555351-76555373 TGGTGGGGGAGGTAGGCAGTAGG - Intergenic
1085508652 11:77074310-77074332 GGCTGGGGATGCCAGGCAGAGGG - Intronic
1085516188 11:77113190-77113212 AGGCGGGGAAGGCAGGCACGTGG - Intronic
1085816452 11:79742294-79742316 TGGTAGGGAAAGCATGCACAGGG - Intergenic
1086310919 11:85535974-85535996 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1086910446 11:92465713-92465735 TGGGGTGGGGGGCAGGCAGAGGG + Intronic
1087840973 11:102920858-102920880 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1088820033 11:113448908-113448930 TGGTCAGGAAGGCAGGCTAAAGG - Intronic
1088826978 11:113504160-113504182 AGGCCGGGAAGGCAAGCAGAGGG + Intergenic
1088834688 11:113567844-113567866 TGGCGGGAAAGGCTGGCAGATGG + Intergenic
1089136485 11:116253311-116253333 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1089534836 11:119154578-119154600 GAGTGGGGAAGGGAGGCAGTGGG + Intronic
1089654167 11:119935069-119935091 TGCAGGAGAAGGCAGGCAGCTGG - Intergenic
1089763212 11:120743963-120743985 TGGTGTGGGAGTCATGCAGAGGG + Intronic
1089785919 11:120906985-120907007 GGGTGGGGATGGCAGGGCGAAGG + Intronic
1089963953 11:122639984-122640006 TGGAAGGGAAGGCTGGCAGCAGG - Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090239087 11:125169438-125169460 TGGTGGGAAAGGGAGGAAGGAGG + Intronic
1090422405 11:126584541-126584563 TGGCTGCAAAGGCAGGCAGAGGG + Intronic
1090841306 11:130489710-130489732 TGATGGTGGGGGCAGGCAGAAGG - Intergenic
1090844976 11:130522753-130522775 TGGTGGGGTTTGCAAGCAGAGGG + Intergenic
1091119882 11:133048020-133048042 GGGTGGGGCAGGAAGGCAGTGGG - Intronic
1091166174 11:133478235-133478257 TGCTGGGAGAGGCAGGCAGGAGG - Intronic
1091287309 11:134414825-134414847 TGGCAGGGAAGGCAGGGGGAGGG - Intergenic
1202825376 11_KI270721v1_random:87106-87128 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1091456228 12:610154-610176 GGATGGGGAAGGCAGGAGGATGG - Intronic
1091652876 12:2322916-2322938 TGGTGCAGCAGGCAGGCGGAGGG - Intronic
1091666790 12:2424688-2424710 GGGAGAGGGAGGCAGGCAGAAGG - Intronic
1091668891 12:2438433-2438455 AGGTGGACATGGCAGGCAGATGG + Intronic
1091815166 12:3432175-3432197 TGATGGTGATGGCAGGGAGAAGG + Intronic
1092030950 12:5284654-5284676 TAGTGGGGAAGTCTGGGAGAGGG - Intergenic
1092051591 12:5474681-5474703 TGATAGGGAAGGCTGGGAGAGGG + Intronic
1092141369 12:6186014-6186036 TGGAGCGGATGGGAGGCAGAAGG + Intergenic
1092358890 12:7819554-7819576 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092372010 12:7924482-7924504 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092843754 12:12565892-12565914 AGATGGGGCAGCCAGGCAGAGGG - Intergenic
1092909049 12:13129180-13129202 GGGAGAGGAAGGAAGGCAGAAGG - Intronic
1093242849 12:16698875-16698897 AGGTGGGGAAGATATGCAGAGGG + Intergenic
1093824526 12:23667123-23667145 TGGTGGGGGCGGCAGAGAGAGGG + Intronic
1094370675 12:29734427-29734449 TGGTGGGACATGCAGGGAGAAGG - Intronic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1094622601 12:32094445-32094467 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1095094252 12:38137175-38137197 CGGAGGCTAAGGCAGGCAGACGG + Intergenic
1096584111 12:52608412-52608434 TGGCCGGGATGGCAGGCACAGGG - Exonic
1096616656 12:52836914-52836936 TGGAGCGGGAGGGAGGCAGATGG - Intergenic
1096634854 12:52951673-52951695 AGGTGTGGGAGGGAGGCAGACGG + Intronic
1096734191 12:53639873-53639895 AGGAGGCCAAGGCAGGCAGATGG - Intronic
1096849420 12:54426074-54426096 AGGTGGGGAAGCCTGTCAGATGG + Intergenic
1096925831 12:55144876-55144898 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1096978623 12:55715965-55715987 TGGCGGGGAAGAGAGGTAGAGGG - Intronic
1097052131 12:56230041-56230063 TGGGGGGGCAGGCAGGCAGGCGG - Intronic
1097195328 12:57239726-57239748 AGGTAGGGAAGGCAGCAAGAGGG - Intronic
1097278249 12:57827618-57827640 GGGTGGGAAAGGCAGTGAGATGG - Intronic
1097678366 12:62626478-62626500 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1097691986 12:62742068-62742090 TAGTGGGCAAGGCAGGGAGGGGG + Intronic
1097750335 12:63345538-63345560 TGGTGGGGAATTGAGGCACAAGG - Intergenic
1098008991 12:66030591-66030613 TGGAGAGGAAGGAAGGGAGAAGG - Intergenic
1098184667 12:67883566-67883588 TGGTGAGGAAGGCAGGGAGTAGG + Intergenic
1099885933 12:88530495-88530517 TAATTGGGAAGGCAGGCAGGGGG - Intronic
1099941278 12:89192050-89192072 TGGAGGTGAAGGCAGGGAGTTGG + Intergenic
1101065769 12:101018765-101018787 TGGAAGGAAAGGCATGCAGAAGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101371054 12:104130917-104130939 GGGTGGGGAGGGCAGGCGGTGGG + Intronic
1101640233 12:106581954-106581976 GGGTGGGGAGGGCAGGGGGAGGG + Intronic
1102035130 12:109766610-109766632 AGGTGAGGAAGGAAGGCATACGG + Intronic
1102464813 12:113122562-113122584 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1102575549 12:113853975-113853997 TGGTGGGCATGGTAGGGAGAAGG + Intronic
1102725754 12:115063109-115063131 GGGTGGGGGTGGCAGGTAGACGG + Intergenic
1102767384 12:115445389-115445411 TTTTGGGGGAGGCAGGCACAGGG - Intergenic
1102996711 12:117357081-117357103 AGGAGGCCAAGGCAGGCAGATGG + Intronic
1103463681 12:121124855-121124877 TGAGAGGGAAGGCAGGCAGGTGG - Intergenic
1103722572 12:122982550-122982572 GGGGGCGGATGGCAGGCAGAGGG - Intronic
1103725270 12:122994668-122994690 TGGTGGGGAAGACAGGAAGGAGG + Intronic
1103947059 12:124532542-124532564 AGGCCGGGAAGGCAGACAGACGG - Intronic
1103967741 12:124650995-124651017 GGGTGGGAAAGGCAAGCAGCGGG - Intergenic
1104285618 12:127421894-127421916 TAGTGGAGAAGGCAGACAGTAGG - Intergenic
1104416156 12:128598175-128598197 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1104587499 12:130059339-130059361 AGGTGGGGAAGCCAGGAGGATGG - Intergenic
1104745904 12:131210409-131210431 TGCAGGGGAATGTAGGCAGAGGG + Intergenic
1105303770 13:19155570-19155592 TGGTGGGGAAGTAAAGCAAATGG - Intergenic
1105799364 13:23889933-23889955 TGGAGGGGGAGACAGGCATAGGG - Intergenic
1106271320 13:28156751-28156773 TGGTAGCCAAGGCAGGTAGATGG + Intronic
1106449578 13:29867975-29867997 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107213992 13:37893806-37893828 TGGTGGGAAGGGCAGTCATATGG + Intergenic
1107534532 13:41315140-41315162 TGTTGGGGAAGGAAGGAGGATGG + Intronic
1107661103 13:42640312-42640334 TGTCGGGGAAGGCAGGGAGAGGG - Intergenic
1107910162 13:45098338-45098360 GGGAGGGCAAGGCAGGCAGACGG + Intergenic
1109005466 13:56869936-56869958 GGGAGGGGAAGGGAAGCAGAAGG - Intergenic
1109112090 13:58334259-58334281 TGTTGGGGAAGTTAGGCATATGG - Intergenic
1109759690 13:66811693-66811715 AGGTGAAGAAGGTAGGCAGATGG - Intronic
1110228074 13:73140721-73140743 TGGTTGGGAGGTCAGGCACATGG - Intergenic
1111008193 13:82276713-82276735 TTCTGGGGAGGGGAGGCAGAGGG - Intergenic
1111951553 13:94712588-94712610 GGGTGGGGAAGGCGGGGAGGTGG + Intergenic
1112144240 13:96679984-96680006 ACGTGGGGAAGGAAGGCAAAGGG + Intronic
1112799958 13:103099758-103099780 TGGTGGGGACGTGAGGAAGAGGG + Intergenic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1112933459 13:104770069-104770091 TGAGAAGGAAGGCAGGCAGATGG + Intergenic
1113755963 13:112811211-112811233 TGGTGTGGGATGCTGGCAGAGGG - Intronic
1113852037 13:113423379-113423401 AGGTGCAGAAGGAAGGCAGAGGG + Intronic
1114913869 14:27236894-27236916 TGGTGAGGAAGGGAGGGAGTTGG - Intergenic
1115063430 14:29223546-29223568 TGGTGGGTGGGGTAGGCAGAAGG - Intergenic
1115267369 14:31514549-31514571 TGGTGGAAAAGGAAGCCAGAAGG + Intronic
1115314831 14:32014595-32014617 TGGAGGGGGAGTCATGCAGATGG + Intronic
1115650316 14:35398328-35398350 TGATGGATAAGGCAGGCAGAAGG + Intergenic
1116039047 14:39663428-39663450 TGGAGGGGAAGGACGGCATAGGG + Intergenic
1116083415 14:40204614-40204636 TGCTGGGGACAGCAGGCTGATGG - Intergenic
1116103343 14:40469001-40469023 TTCTGGAGAAGCCAGGCAGAAGG - Intergenic
1117033813 14:51705719-51705741 TGATGGGGAAAGAAGGCAGATGG - Intronic
1117329612 14:54699405-54699427 AGATGGGGAAGGCTGGCAGGAGG - Intronic
1117943958 14:60998268-60998290 ATGCGGGGATGGCAGGCAGAAGG - Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118350816 14:64971754-64971776 TGGTCCGGACGGCAGGCAGCAGG + Intronic
1119101712 14:71885974-71885996 TGGAGGGGAAGGGAAGGAGAGGG - Intergenic
1119419974 14:74502743-74502765 TGTTGGGGAAGGCAGGCTCAGGG + Exonic
1119546327 14:75474489-75474511 TGGACTGGAAGGCAAGCAGAGGG + Intergenic
1119668164 14:76499301-76499323 AGAGGGGGAAGGCAGGAAGAGGG - Intronic
1120193422 14:81459938-81459960 TGGTGGAGGAGGAAGGCACAGGG - Intergenic
1120755488 14:88240134-88240156 TGATGAGGCAGGCAGGAAGAAGG + Intronic
1121120274 14:91371948-91371970 GGGTGGGAAAGGCAGGCAGTGGG + Intronic
1121563000 14:94888007-94888029 AGGTGGGGAAGGCAGGGTGATGG - Intergenic
1121745521 14:96287392-96287414 TGGTGGAGAGGGGAGGGAGATGG - Intronic
1121838660 14:97114884-97114906 AGGTGGGGAAGGCAGGGAAAGGG + Intergenic
1122074732 14:99228782-99228804 TGGTGGGGAGGACAGGGAGTGGG - Intronic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122359645 14:101151711-101151733 TGGTGAGCAAGGCAGGGAGGTGG - Intergenic
1122419611 14:101567180-101567202 AGGTGGGGCAGGCAGTCAGATGG + Intergenic
1122559191 14:102599369-102599391 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1123020225 14:105394476-105394498 TGGTGGGCCAGGCAGGCAGGTGG + Intronic
1202930701 14_KI270725v1_random:30513-30535 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1123421655 15:20140899-20140921 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1123443401 15:20305617-20305639 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1123530881 15:21147439-21147461 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1124961175 15:34396791-34396813 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1124977805 15:34543012-34543034 TGGTGGGGTTGGCGGGGAGAGGG - Intronic
1125284069 15:38073277-38073299 GGGTGGGGGAGGCCGGGAGAGGG - Intergenic
1125285469 15:38088163-38088185 GGATGGGGAAGGGAGGAAGAAGG - Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125741222 15:41966223-41966245 TGGTGGTGAAGGAAGCCAGATGG - Intronic
1125768646 15:42151019-42151041 TGGAGGGGAAGGCAGGGAGCGGG + Intronic
1126138032 15:45411421-45411443 TGGTGGGGCACTGAGGCAGAAGG - Intronic
1126359713 15:47833896-47833918 TTATGGGAAAGGCTGGCAGATGG + Intergenic
1126383573 15:48071871-48071893 TGGTGGGGCAGGGAGGGAGTAGG - Intergenic
1126557019 15:49999836-49999858 GGGTGGGAAAGGCAGGGAGGTGG - Intronic
1126579907 15:50233170-50233192 AGGAGGTGAAGGCAGGCACAGGG - Intronic
1126748349 15:51850019-51850041 TGGTGGGGATGAAAGCCAGATGG + Intronic
1126788609 15:52199729-52199751 TGGTGGCGAAGGAGGCCAGAAGG + Intronic
1126851814 15:52801710-52801732 GGATGGTGAAGGCAGCCAGAGGG + Intergenic
1127227618 15:56949899-56949921 TAGTGGGGAAGACAGGAAAAGGG + Intronic
1127377974 15:58402440-58402462 GGGTGGGGGAGGCAGGAAGCAGG - Intronic
1127381938 15:58438152-58438174 TGGAGAGGAGGGCAGGGAGAGGG - Intronic
1127441654 15:59014986-59015008 CGGAGGCCAAGGCAGGCAGATGG - Intronic
1127559830 15:60125097-60125119 TGGGTGGGTAGGCAGGTAGATGG + Intergenic
1127560596 15:60132571-60132593 AGGTGGGGAAGGGAGGGAGAAGG + Intergenic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1127709990 15:61587701-61587723 TGGAGGTGAGGGCAGGCCGAAGG + Intergenic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1128549868 15:68591121-68591143 TGTTGGGGAAGGGAGGCTGATGG + Intronic
1128791697 15:70439067-70439089 AGGCGGGCGAGGCAGGCAGAGGG + Intergenic
1129384061 15:75185899-75185921 TGGAGGGGAAGGGAGGAAGAGGG + Intergenic
1129439975 15:75574343-75574365 TTGCGGGGCAGGCAGGCTGAGGG + Intronic
1129444604 15:75608139-75608161 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129692232 15:77720372-77720394 TGGGGGCGGATGCAGGCAGAGGG - Intronic
1129787886 15:78321331-78321353 TGGTGGGGAACAAAGGCAGTGGG - Intergenic
1129807098 15:78471246-78471268 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1129904048 15:79173441-79173463 TGGGGGGGAAAGCAGGCAAAGGG - Intergenic
1130220127 15:82012387-82012409 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1130231735 15:82102432-82102454 TGGTGGAGCATGCAGGCAGCAGG - Intergenic
1130458901 15:84143284-84143306 TGGTAGGTAGGGCAGGCAGCAGG + Intergenic
1130995553 15:88901900-88901922 TGGTGGGGTCGGCAGTGAGAAGG - Intronic
1131869502 15:96747194-96747216 TGTAGGGAAAGACAGGCAGATGG + Intergenic
1132028972 15:98425285-98425307 TGCAGGGGAGGGAAGGCAGAGGG + Intergenic
1132060603 15:98689464-98689486 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1132148435 15:99442766-99442788 TGTTGGGGCTGGCAGGGAGAGGG - Intergenic
1132177923 15:99730121-99730143 TGAGGGGGAAGGCAGGCAGATGG - Intronic
1132338724 15:101064877-101064899 TGGGGGGGGTGGCAGGCAGGGGG + Intronic
1132493848 16:250409-250431 GGGTGGGGAAGGCAGGACGTGGG - Intronic
1132704662 16:1237888-1237910 TGCTGGAGAAGGCAGCCCGATGG + Intergenic
1132706851 16:1248537-1248559 TGCTGGAGAAGGCAGCCCGATGG - Intergenic
1133112368 16:3556087-3556109 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1133113897 16:3565081-3565103 TGGGGGGCACGGCAGGCAGCAGG - Exonic
1133343385 16:5053784-5053806 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1133351398 16:5103083-5103105 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1133408536 16:5548221-5548243 TGGTGGGGGAGAAAGGAAGAAGG + Intergenic
1133433223 16:5756629-5756651 TGGCTGGAAAGGCAGGCAGCAGG - Intergenic
1133894270 16:9910775-9910797 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1134052873 16:11149181-11149203 TGGTGAGTCAGGCAGGCAGCGGG + Intronic
1134104385 16:11475612-11475634 TGGTGAGGAAGGTAGGCAGCAGG - Exonic
1134108224 16:11499120-11499142 AAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108235 16:11499143-11499165 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108257 16:11499188-11499210 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108268 16:11499211-11499233 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108279 16:11499234-11499256 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108290 16:11499257-11499279 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108301 16:11499280-11499302 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108323 16:11499327-11499349 AGAGGGGGAAGGGAGGCAGAGGG + Intronic
1134672609 16:16067009-16067031 AGGTGGCCGAGGCAGGCAGATGG + Intronic
1134743168 16:16566483-16566505 TGGGGGGGAAGGGAGGGAGGGGG - Intergenic
1134924392 16:18145977-18145999 TGGGGGGGAAGGGAGGGAGGGGG + Intergenic
1135507350 16:23050432-23050454 TGCTAGGGAAGGGAGGCAGGAGG + Intergenic
1135872077 16:26160513-26160535 TGGTGGAGAGGGCAGGGAGATGG + Intergenic
1135955472 16:26953118-26953140 TGGTGGGTGAGGCAGGGAGGCGG - Intergenic
1136278938 16:29196834-29196856 TGGTGGGGGAGGGAGGGAGTAGG + Intergenic
1136403123 16:30029124-30029146 TGGGGTGGAAGGCAGGGAGGAGG + Intronic
1136453593 16:30368712-30368734 AGGTGGGGAAGTCTGGCTGATGG - Intronic
1136863181 16:33714738-33714760 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1136891875 16:33976736-33976758 GGGAGGGGAGGGCAGGGAGAGGG - Intergenic
1136910433 16:34140833-34140855 CGGTGGGGCGGGGAGGCAGAGGG + Intergenic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137501295 16:49013437-49013459 TGGGAGGGAATGCAGGCAGGGGG + Intergenic
1138059039 16:53869737-53869759 TGATGGGGAACGTAAGCAGAGGG - Intronic
1138277435 16:55746028-55746050 GGGAGAGGAGGGCAGGCAGAAGG + Intergenic
1138530273 16:57630970-57630992 TGGGGGGGAAGAGAGGCAGGAGG + Intronic
1138927696 16:61612159-61612181 TGGAGGGGAAGGAAGGGAAAAGG + Intergenic
1139220349 16:65175498-65175520 AGGTGGTAAAGGCAGGCAGCAGG - Intergenic
1139344101 16:66290837-66290859 TTCTGGCCAAGGCAGGCAGAGGG + Intergenic
1139476191 16:67203611-67203633 AGGTGGGCAGGGGAGGCAGATGG + Intronic
1139900191 16:70322104-70322126 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1139916431 16:70431093-70431115 GCGTGGGGGAGGCAGGCAGCAGG + Intronic
1139961219 16:70718608-70718630 TGCTTGGGAAGGCAGCCACATGG + Intronic
1141030325 16:80581967-80581989 AGGTGGGGAAGCCAGGTAGTAGG - Intergenic
1141080565 16:81047992-81048014 TGGGGGAAAAGGAAGGCAGAAGG + Intergenic
1141143666 16:81514246-81514268 GGGTGGGGCAGGCAGGGAGGAGG + Intronic
1141381382 16:83580075-83580097 TGGGAGGAAATGCAGGCAGAGGG + Intronic
1141408006 16:83810588-83810610 GGGAGGCAAAGGCAGGCAGAGGG + Intronic
1141429178 16:83962140-83962162 TGATGGGGCAGGAAGCCAGATGG - Intronic
1141444159 16:84047414-84047436 TGCTGGGAAAGGCAGGGAAATGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141613479 16:85197160-85197182 TGGCGGGGAAGCCAGACACAGGG + Intergenic
1141737662 16:85864736-85864758 TGGTGGGGAAGGGTGGAAGTGGG + Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1142010223 16:87710049-87710071 GGCTGGGGAAGCCAGGCTGAGGG + Intronic
1142158972 16:88547312-88547334 GGGTGGGGAAGGCGAGGAGAGGG + Intergenic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142359919 16:89621140-89621162 GGGTGGGGAGGCCAGGCTGAGGG + Intronic
1203124673 16_KI270728v1_random:1562891-1562913 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1142660207 17:1423812-1423834 TTGTGGTTAATGCAGGCAGAAGG + Intronic
1142676048 17:1513978-1514000 TGCTGCGGAAGGGATGCAGAGGG + Exonic
1142717555 17:1755316-1755338 TGGTGGGGAAGGCAGGGAGGCGG + Intergenic
1142856089 17:2731244-2731266 TGGGGGGACAGGCAGGCAGAGGG - Intergenic
1142990253 17:3725324-3725346 TTATGGGGAATGCAGTCAGAAGG + Exonic
1143020341 17:3914328-3914350 TGGGAGGGAAGACAGGCAGGAGG + Intronic
1143022506 17:3924105-3924127 TGGTCTGCAAGGCAGGCTGAGGG + Intronic
1143102911 17:4514026-4514048 TCATGGGGAAGGCAGGGACAAGG - Intronic
1143344504 17:6240031-6240053 TGAGGGGGGAGGCAGGGAGATGG - Intergenic
1143514762 17:7414123-7414145 CCGCGGGGAAGGCTGGCAGAGGG + Intronic
1143724883 17:8837963-8837985 TGGGGTGGAAGGCAGCCAGGGGG + Intronic
1144099251 17:11929778-11929800 TTGTCAGGAAGGCAGCCAGAGGG - Intronic
1144287801 17:13795360-13795382 TGGTGGAGAAGGGAGACAAAGGG + Intergenic
1144705955 17:17367983-17368005 TGATGGCGAAGGCAGGAATAGGG + Intergenic
1145027512 17:19479515-19479537 TGAAGGCCAAGGCAGGCAGATGG - Intergenic
1145742002 17:27282602-27282624 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1146502640 17:33377540-33377562 TGGAGGGTAAGGCAGAGAGAAGG - Intronic
1146722625 17:35133794-35133816 TTGGGGGGATGACAGGCAGATGG - Intronic
1146792869 17:35762716-35762738 TGGTGGGGTGGGCAGGCGGGTGG - Intronic
1146827237 17:36033423-36033445 TGGTGGGGAAGGGAAGGAGAAGG - Intergenic
1146928569 17:36762054-36762076 TGGGGGAGAAGGCAGGGGGAGGG + Intergenic
1147187794 17:38722089-38722111 TGGGGGGGCTGGCAGGCAGTGGG + Exonic
1147558487 17:41494901-41494923 TGGAGGGGCAGCCAGGCAGTGGG - Intergenic
1147839571 17:43361763-43361785 CGGAGGGGAAGGGAGGCGGAGGG - Intergenic
1147846363 17:43406850-43406872 TGGTGGCGGAGGTGGGCAGATGG + Intergenic
1147988649 17:44320438-44320460 TGGTGGGGTGGGCGGGGAGAGGG + Intronic
1148050698 17:44768749-44768771 TGGTGGGGACGGCAGGTTGCAGG - Intronic
1148146414 17:45367708-45367730 GGGTGGGGCAGGCGGGGAGAGGG + Intergenic
1148218570 17:45847272-45847294 GGGTTGGGCAAGCAGGCAGAGGG - Intergenic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1149468172 17:56895581-56895603 TGCTGGGTAAGGCAGGGACAGGG + Exonic
1149620758 17:58043285-58043307 AGGTGGGCAAAGGAGGCAGATGG + Intergenic
1149685404 17:58531940-58531962 TGGTAAGGCAGGCAGGCAGGCGG - Intronic
1149917876 17:60628281-60628303 TAGTGGGGAAGCCTGGGAGACGG - Intronic
1150433895 17:65139456-65139478 AGGTGTGGAAGGCAGGCAGGAGG - Intronic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151266433 17:72959562-72959584 TTGGGGGGAAGGGTGGCAGAGGG + Intronic
1151286200 17:73113381-73113403 TGGTGGTGAAGGCAGGCCCCAGG - Intergenic
1151480333 17:74366794-74366816 TTGAGGGGTAGGGAGGCAGAAGG + Intergenic
1151488518 17:74417746-74417768 GGGTGGGGAGGGCAGCCAGTTGG + Intergenic
1151544484 17:74784409-74784431 TGGAGGGGAAGGAAGGAGGATGG + Intronic
1151818272 17:76482400-76482422 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152324025 17:79625160-79625182 GGGTGGGGAATACAGGGAGAGGG - Intergenic
1152369712 17:79878700-79878722 TGGAGCAGAGGGCAGGCAGAGGG - Intergenic
1152486499 17:80597751-80597773 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1152552869 17:81038557-81038579 TGGTGGGGAAGCCAGCCTGGCGG + Intronic
1152686483 17:81696208-81696230 CTCTGGGGGAGGCAGGCAGAGGG - Intronic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1152868233 17:82736707-82736729 TGGTGGGGAGTGCTGGCAGGAGG + Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153372854 18:4339320-4339342 GTGTTGGGAAGGCAGCCAGAGGG + Intronic
1153819132 18:8817986-8818008 TGCTGAGGCAGGCAGGCAAATGG - Intronic
1154008087 18:10551174-10551196 GGGAGGCCAAGGCAGGCAGATGG - Exonic
1154334713 18:13456282-13456304 CGCTCAGGAAGGCAGGCAGACGG - Intronic
1154483412 18:14857137-14857159 AGGGGGGGCAGCCAGGCAGAGGG + Intergenic
1154483832 18:14858757-14858779 AGGGGGGGCAGCCAGGCAGAGGG + Intergenic
1154502830 18:15005079-15005101 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
1154945292 18:21156931-21156953 TGGTGGGGTAGGCAGGTGGATGG + Intergenic
1155074297 18:22341547-22341569 TGGTGTGGGATGAAGGCAGAGGG - Intergenic
1155112373 18:22728543-22728565 TGGTGGTGAAGCCAAGCAGATGG - Intergenic
1155136175 18:22994963-22994985 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1155397363 18:25400762-25400784 TGGTAAGCAAGGCAGGCAGTAGG + Intergenic
1156207439 18:34901440-34901462 TGGTTGGGTAGTCAGGCAGAGGG + Intergenic
1157111214 18:44821947-44821969 TGCTGGAGCAGGAAGGCAGAAGG + Intronic
1157287944 18:46390125-46390147 GGGTGGGGAGGTCAGGAAGAGGG - Intronic
1157363306 18:47039367-47039389 TGGAGGGGATGGCAGGTAAAGGG - Intronic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1157664105 18:49470828-49470850 TGGTGGGGAAGGTTGGGAGGGGG - Intergenic
1157818966 18:50751573-50751595 GGTTGGGGGAGGCAGGGAGAGGG + Intergenic
1157972726 18:52288707-52288729 TGGTGGAGAAGGGTGGGAGAAGG + Intergenic
1158240693 18:55374659-55374681 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1158313092 18:56179783-56179805 TGGTATGAAAGGCAGGCACATGG + Intergenic
1158375959 18:56867274-56867296 AGGAGGCCAAGGCAGGCAGATGG - Intronic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160436698 18:78857404-78857426 TGGAGGGGAAGGCCGGGAGCTGG - Intergenic
1160832648 19:1110930-1110952 TGGTGAGCAAAGCAGGGAGAGGG - Intronic
1160919074 19:1511589-1511611 TGGTGGGGAGGGCGGGGAGGGGG - Intronic
1160939839 19:1615075-1615097 TGCTGAGGCAGGCAGGGAGAAGG + Intronic
1160941086 19:1620827-1620849 TGCTGGGATAGGCAGGCAGCGGG - Intronic
1160995040 19:1878573-1878595 TGGTGGAGATGCCAGGCAGAGGG - Intronic
1161220737 19:3116925-3116947 GGGTGGGGAGAACAGGCAGATGG - Intronic
1161416779 19:4151711-4151733 AGGAGGGGAAGGCAGGGAGGAGG - Intergenic
1161496759 19:4590824-4590846 TGGGGGGAGAGGGAGGCAGAAGG - Intergenic
1161690025 19:5726768-5726790 TGCTGGGGGAAGCTGGCAGAAGG - Intronic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1162305723 19:9872270-9872292 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1162457555 19:10795158-10795180 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1162480177 19:10923131-10923153 TGGGGGGCAGGACAGGCAGAGGG + Exonic
1162568440 19:11457208-11457230 GGGTGGGGAGGGCAGGCCGACGG - Intronic
1162717148 19:12641359-12641381 TGGCGGGGAAAGCAGGGGGAAGG - Intergenic
1162964807 19:14150789-14150811 TGGTGGGAGAGGGAGACAGATGG - Exonic
1163198887 19:15747821-15747843 CGGTGGGGGAGGGAGGGAGAGGG + Intergenic
1163441648 19:17324969-17324991 AGCTGAGGAAGGCAGGCAGGCGG + Exonic
1163645713 19:18487966-18487988 AGGTGGGGCCGGCAGGCACAGGG - Intronic
1163702215 19:18791517-18791539 TGGTGGGGCAGGGAGTCAGGGGG + Intergenic
1163790359 19:19302661-19302683 GGGTAGGGCAGGAAGGCAGATGG + Intronic
1164017284 19:21264472-21264494 AGATGGGGCAGCCAGGCAGACGG - Intronic
1164186196 19:22871642-22871664 TGGGGTGGCAGCCAGGCAGAGGG + Intergenic
1164419672 19:28077857-28077879 AGGTGGGGAAGGCAGCCTGGAGG - Intergenic
1164441735 19:28284622-28284644 TGAGGGGGAAGGAAGGTAGAGGG + Intergenic
1164524129 19:29001075-29001097 TGGTCGGGGAGGCGGGGAGAGGG + Intergenic
1164583147 19:29447580-29447602 GGCTGGGAAAGGCAGCCAGAGGG - Intergenic
1164797028 19:31041603-31041625 AAGTGGGGAAGGCAAGCAGCTGG + Intergenic
1164907480 19:31978880-31978902 TGGTGGAGAAAGCAGGTGGAAGG - Intergenic
1165276022 19:34752388-34752410 TGGTGAGGAATGAAGGCAGGTGG - Intergenic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1165487717 19:36105414-36105436 TGCTGGGCAAGGTAGGCACATGG - Intergenic
1165488311 19:36108611-36108633 GGGAGGCCAAGGCAGGCAGACGG + Intergenic
1165795171 19:38515146-38515168 TGGAGGGGAAGGGAGGGAGCAGG + Intronic
1165828412 19:38718725-38718747 GGATGGGGAAGACACGCAGAGGG - Intronic
1165888843 19:39098815-39098837 TGCCGGGGAAGGCAGACCGAAGG + Intronic
1165912690 19:39238647-39238669 GGGTGGGGGAGGCAGGAACAGGG + Intergenic
1165937871 19:39400137-39400159 GGGAGGTGCAGGCAGGCAGATGG + Exonic
1166201833 19:41242792-41242814 TGATGTGGGAGGGAGGCAGAAGG - Intronic
1166214278 19:41325431-41325453 CGGTGAGGGAGGAAGGCAGAGGG - Intronic
1166302083 19:41916955-41916977 TGGAGGGACAGGCAGACAGATGG - Intronic
1166373433 19:42314592-42314614 TCCTGGGGAAGGCAGGGACAGGG - Exonic
1166434833 19:42758581-42758603 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166444706 19:42848605-42848627 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166447688 19:42872349-42872371 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166452142 19:42911162-42911184 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166454596 19:42930024-42930046 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166464395 19:43019352-43019374 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166484143 19:43198577-43198599 AGGTGGGTCAGGCAGGCAGTTGG - Intronic
1166516342 19:43449915-43449937 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1166959083 19:46487277-46487299 TGCTGGGGGAGTCAGGCAGCGGG - Intronic
1167231924 19:48290461-48290483 TGCTGGGAAACGCAGGCAGCAGG - Intergenic
1167365584 19:49053519-49053541 TGGCTGGGATGGGAGGCAGATGG + Intergenic
1167616254 19:50535851-50535873 TGGTGGGGAAGGGTGGGAGGCGG - Intronic
1167716611 19:51146287-51146309 AGGTGTGTAAGGCAGGAAGAGGG + Intronic
1167728007 19:51231999-51232021 GGGAGGTGAAGGCAGGCAGGTGG - Intronic
1167830897 19:52021636-52021658 AGGAGGCTAAGGCAGGCAGATGG + Intronic
1168317053 19:55489052-55489074 TGGGGGGGGGGGCGGGCAGATGG - Intronic
1168543485 19:57231580-57231602 GGAAGGGGAAGGCAGGGAGAGGG - Intronic
1202691389 1_KI270712v1_random:97365-97387 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
925823053 2:7819467-7819489 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
926110945 2:10183464-10183486 TGGAGGGGCAGGCAGCCAGGAGG - Intronic
926145362 2:10393873-10393895 GGGAGGCCAAGGCAGGCAGATGG + Intronic
926148015 2:10408602-10408624 TGGTGGGGAGGGGCTGCAGAAGG - Intronic
926436592 2:12844591-12844613 TGGTGGTGAAGGCATCCACAGGG - Intergenic
927173114 2:20387004-20387026 TGTGGTGGAAGGCAGACAGAAGG - Intergenic
927280193 2:21298245-21298267 TTGTGGGGGAGGCAGGGATATGG - Intergenic
927484426 2:23478970-23478992 AGGGAGGGAAGGCAGGCAGCGGG - Intronic
927659991 2:24985035-24985057 TGGTGGGGAAACAAGCCAGAGGG + Intergenic
927690816 2:25206934-25206956 TGGTGGGCCAGGATGGCAGAAGG + Intergenic
927732439 2:25486221-25486243 GGGAGGCCAAGGCAGGCAGATGG + Intronic
928008253 2:27582760-27582782 GGATGGGGAAGGCAGGCTGGAGG + Intergenic
928100060 2:28431762-28431784 TGGTGGGGAAAGCAGGCTGAGGG - Intergenic
928135527 2:28684859-28684881 GGGTGGGGCAGGGAGGAAGAAGG - Intergenic
928426964 2:31187355-31187377 TGGAGGGGAGCGCAGGGAGAAGG - Intronic
928547961 2:32345484-32345506 GGGAGGTCAAGGCAGGCAGATGG - Intergenic
929071098 2:38031426-38031448 TGGTGGGGGAGGCTGGGAGGTGG - Intronic
929799297 2:45085589-45085611 GGGTGGTGAAAGGAGGCAGATGG + Intergenic
930058337 2:47269092-47269114 TGGAGGCCAGGGCAGGCAGATGG + Intergenic
930088137 2:47512764-47512786 GGTTGGGGAGGGCAGGAAGAGGG + Intronic
930332299 2:50000817-50000839 TGGTGAGCAAGGCAGGCTGGAGG + Intronic
930444569 2:51453498-51453520 CAATGAGGAAGGCAGGCAGAAGG - Intergenic
930526361 2:52535467-52535489 TGATGGGGATGGCTAGCAGAAGG - Intergenic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
932281708 2:70498563-70498585 TGGAGGGGAGGGGAGGTAGAAGG + Intronic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932758365 2:74424002-74424024 GGGTGGGGAAGGCTCCCAGATGG - Intronic
932833611 2:75013551-75013573 TGGTGGCAAAGGCATGCAGTGGG + Intergenic
933657826 2:84904264-84904286 GGGAGGTTAAGGCAGGCAGATGG + Intronic
933918330 2:87019006-87019028 TGGTGGGGGCTGCAGGCAGAGGG + Intronic
933987583 2:87604681-87604703 AGGTGGGGAAAGGAGGGAGAAGG - Intergenic
934004666 2:87750907-87750929 TGGTGGGGGCTGCAGGCAGAGGG - Intronic
934239192 2:90252799-90252821 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934323312 2:91985347-91985369 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934461631 2:94216153-94216175 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934563282 2:95323996-95324018 TGATGGGGCGGGGAGGCAGAGGG + Intronic
934614433 2:95762537-95762559 GGGTGGGGCAGGGTGGCAGAGGG + Intergenic
934646472 2:96061962-96061984 GGGTGGGGCAGGGTGGCAGAGGG - Intergenic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
935062612 2:99621585-99621607 TGGTGGGGACAGAAGGCACAAGG + Intronic
935717623 2:105952954-105952976 GGGTGAGGAAGGCAGGAGGAAGG - Intergenic
935767623 2:106384940-106384962 TGGTGGGGGCCGCAGGCAGAGGG - Intergenic
936087409 2:109478683-109478705 TGGTGGGGAAGGGAGAGAGGGGG + Intronic
936159185 2:110071133-110071155 GAGTGGCCAAGGCAGGCAGATGG + Intergenic
936185476 2:110300199-110300221 GAGTGGCCAAGGCAGGCAGATGG - Intergenic
936306257 2:111346127-111346149 AGGTGGGGAAAGGAGGGAGAAGG + Intergenic
937002080 2:118477114-118477136 CAGGGGGGCAGGCAGGCAGACGG - Intergenic
937334635 2:121054431-121054453 TTGTGGGGAAGGGTGGCAGATGG + Intergenic
937356377 2:121200522-121200544 AGGAGGGAGAGGCAGGCAGATGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
937884427 2:126890190-126890212 TAGTGGGGAATGCAGGGAGTAGG + Intergenic
938094406 2:128452168-128452190 TGGTGGGTAATGGAGGCTGATGG - Intergenic
938501997 2:131835249-131835271 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
938698220 2:133853776-133853798 AGGAGGGTAAGGCAGGAAGACGG + Intergenic
938790670 2:134672880-134672902 TGATGGGCAGGGCAGGCAGTGGG - Intronic
939467893 2:142581770-142581792 TGGTGTAGAGGGGAGGCAGAGGG - Intergenic
939718041 2:145610103-145610125 TGGTGTGGAAGAAAGGGAGATGG - Intergenic
940534061 2:154915967-154915989 TGGTAGGAAAGGGAGCCAGATGG + Intergenic
941102743 2:161314542-161314564 GGGTGGGGAAGGGAGGAAAATGG - Intronic
941129899 2:161634859-161634881 GGCTGGGGAAGGTAGGGAGAAGG - Intronic
941415817 2:165219788-165219810 TGGTGGGGATGACAGGAAGCAGG + Intergenic
941721001 2:168812778-168812800 AGGTGGGAAAGGCAGAGAGAGGG + Intronic
941874287 2:170417692-170417714 TGAAGGTGAAGGCAGACAGAGGG - Intronic
941961935 2:171262390-171262412 TGGTGGGGAGGGAAGTCACAAGG + Intergenic
942050070 2:172131584-172131606 GGGAGGACAAGGCAGGCAGATGG + Intergenic
942087365 2:172455986-172456008 AGGTGGGGAAGGCAGGGAAGTGG + Intronic
942129938 2:172868471-172868493 TAATGGGGAAGGGAGACAGAGGG + Intronic
943442508 2:187943325-187943347 TGGAGGGGTTGGCAGGGAGAGGG - Intergenic
943771959 2:191727685-191727707 TCGTGGAGAAGGGAGGGAGAAGG - Intergenic
944278262 2:197864711-197864733 GGGAGGCCAAGGCAGGCAGAAGG - Intronic
944667849 2:201971820-201971842 TGGTGGTGATGACAGTCAGAGGG + Intergenic
944746898 2:202666441-202666463 AGGTGAGGATGGCAGACAGAAGG + Intronic
944809332 2:203312383-203312405 TGTAGGGGAAGGCATGCAGGTGG + Intergenic
945807346 2:214505922-214505944 TGGTGGGGAAGGTGAGCACAGGG + Intronic
946044665 2:216810937-216810959 TGATGGGGAAGCAAGGCAGCTGG + Intergenic
946187729 2:217990743-217990765 TGGTGGGCATGGCAGGTGGAGGG - Intronic
946194883 2:218027006-218027028 TGGAGGGGAAGTCAGGGAGGAGG + Intergenic
946276083 2:218632905-218632927 CTATGGGGAAGGGAGGCAGAGGG + Intronic
946301856 2:218828679-218828701 GGGAGGGGACAGCAGGCAGATGG - Intronic
946427667 2:219608153-219608175 TAGTGGGGGTGGCCGGCAGAGGG - Exonic
946574149 2:221056560-221056582 TGGTGTGGGAGGGACGCAGAGGG - Intergenic
946642800 2:221802372-221802394 AGGGGAGAAAGGCAGGCAGAAGG - Intergenic
946964843 2:225026761-225026783 TTGTGGGGAAGGCAGAGAGAAGG + Intronic
947055259 2:226092390-226092412 TGGTGAGGCAGGCAGAGAGATGG - Intergenic
947367314 2:229410019-229410041 TGGTGAGGAGGGCAGGAAGAGGG - Intronic
947377755 2:229514000-229514022 TCAAGGGGAAGGCAGGCAGTGGG - Intronic
948422093 2:237865845-237865867 TGGTGGTGGAGGGAGGCAGATGG + Intronic
949007553 2:241658305-241658327 TGGTGGGGCAGGGGGGCAGTGGG + Intronic
1168879730 20:1196182-1196204 TGGTAGGAAAGGCAGGTTGAAGG + Intergenic
1168990972 20:2095436-2095458 TGGTGGGAAACACAGGAAGAGGG - Intergenic
1169139962 20:3222098-3222120 TGGTTGGGGAGGCAGCCAGATGG + Intronic
1169206698 20:3744840-3744862 TGGGTGGGAATCCAGGCAGAGGG - Intronic
1169244137 20:4012171-4012193 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1169817602 20:9674339-9674361 TTGAGGGGTAGGCAGGGAGAGGG - Intronic
1169818997 20:9688295-9688317 GTGTTGGGGAGGCAGGCAGAGGG - Intronic
1170306545 20:14944855-14944877 TTGTGGGACGGGCAGGCAGAAGG - Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171433951 20:25104762-25104784 TGGAGGGGAAGGAGGGCAGCAGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172136144 20:32688276-32688298 AGGGAGGGAAGGCAGGAAGAAGG - Intergenic
1172212932 20:33213680-33213702 TGGAAGGGGAGCCAGGCAGAGGG - Intergenic
1172343182 20:34175505-34175527 GGGTGTGGAAGGCAGGAGGAGGG + Intergenic
1172592075 20:36124923-36124945 TGGTGGGTAGGGGAGGCAGCGGG + Intronic
1172725075 20:37033552-37033574 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172952138 20:38728952-38728974 GGGTTGGGAAGGGAGGGAGAGGG + Exonic
1172994315 20:39058811-39058833 TGGTGGAAAAGGGAGGGAGAGGG - Intergenic
1173390524 20:42628098-42628120 GGGTGGGGAAAGAAGGCAAATGG + Intronic
1173677111 20:44845508-44845530 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1173934257 20:46847390-46847412 TGGTGGGGGAGGCAGAGTGATGG - Intergenic
1173947558 20:46963737-46963759 TGGTGGTGAGGACAGGCAGCTGG + Intronic
1174065997 20:47866615-47866637 AGGTGGGGGATGCAGGGAGAAGG - Intergenic
1174066898 20:47872287-47872309 TGGTGGGGAAGGCAGAGCAAAGG + Intergenic
1174157319 20:48524138-48524160 TGGTGGGGAAGGCAGAGCAAGGG - Intergenic
1174354131 20:49987213-49987235 TGGTGAGGAAAGCAGGCTGCTGG + Intronic
1174358760 20:50015222-50015244 TGGGGGGGCCGGCAGGCAGGGGG - Intergenic
1174559612 20:51421314-51421336 AGGAGGGGAAGGAAGGTAGAGGG + Intronic
1174738600 20:52989398-52989420 TGGATGGGAAGTCAGTCAGATGG + Intronic
1175129408 20:56778151-56778173 TGGGAGCCAAGGCAGGCAGATGG - Intergenic
1175499107 20:59436959-59436981 TGTTTGGGAAAGCAGGTAGAAGG - Intergenic
1175807586 20:61838299-61838321 TGGAGGGGAAGGCAGGAGGTGGG + Intronic
1175813340 20:61870536-61870558 TGGTGGGGGTGGCAGGATGATGG - Intronic
1176141940 20:63548681-63548703 TGCTGGGGGAGGCCGGCAGGAGG - Intronic
1176592722 21:8659136-8659158 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1176907576 21:14521708-14521730 TGGGGTGGAGGGCAGGGAGACGG + Intronic
1177642281 21:23858792-23858814 TGGAGGGCAAGGGAGGCAGAGGG + Intergenic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178745823 21:35249240-35249262 TTGTGGGGATTGCAGGCAGGTGG + Intronic
1178873951 21:36398291-36398313 GGGTGGCCAAGGCAGACAGATGG - Intronic
1179478043 21:41660279-41660301 TGGTGGGGAGTGGGGGCAGAGGG - Intergenic
1179714356 21:43280022-43280044 AGGAGGGGAAGGGAGGTAGAGGG + Intergenic
1180275575 22:10636278-10636300 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1180550054 22:16531218-16531240 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1180990416 22:19932448-19932470 TGGCGAGGAAGGCAGGCAAGGGG + Intronic
1181304852 22:21909958-21909980 TGGAAGGCAGGGCAGGCAGAGGG - Intergenic
1181306848 22:21921863-21921885 GGGGTGGGAATGCAGGCAGATGG + Exonic
1181354617 22:22290603-22290625 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181457766 22:23069623-23069645 TGGGAGGGAAGGAAGGGAGAAGG - Intronic
1181483924 22:23218768-23218790 TGGAGGGGAGGCAAGGCAGAGGG + Intronic
1181595767 22:23913611-23913633 TGGAGGGGAAAGAAGGGAGATGG - Intergenic
1181635958 22:24174977-24174999 TGGTGGGACAGGCAGGCAGAGGG - Intronic
1182567407 22:31210624-31210646 TGGTGTGGAACGGAGGGAGAGGG + Intergenic
1183007658 22:34916663-34916685 AGGAGGGGAAGGGAGGGAGATGG + Intergenic
1183515360 22:38262422-38262444 TGGACGGAAAGGCAGGCAAAGGG + Intronic
1183605439 22:38864888-38864910 TGGGAGGGCAGGCAGGCAAAGGG - Exonic
1183721923 22:39567693-39567715 TGCTGGTGAAGACAGGGAGAAGG - Intergenic
1184028816 22:41878764-41878786 AGGTGGGGAGGGCAGGCCCATGG - Intronic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
1184098592 22:42329814-42329836 GGATGGGGCAGGCAGGCAGGGGG - Intronic
1184239342 22:43203763-43203785 TCCTGGGGAAGGGAGGCAGAGGG + Exonic
1184264977 22:43342133-43342155 TGGAGGGGGAGGCAGGGGGAGGG - Intronic
1184645288 22:45891866-45891888 TGGAGGGGAAGAGAGGCAGAGGG - Intergenic
1184657282 22:45948208-45948230 TGAGGGGCCAGGCAGGCAGATGG + Intronic
1184728216 22:46358246-46358268 AGGTGGGGCAGCCAGGCAGAAGG + Intergenic
1184753404 22:46502294-46502316 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
1184833701 22:47007699-47007721 TGGTGGGGAGGGGTGGCAGTGGG + Intronic
1185168192 22:49275194-49275216 GGGTGGGGAACGCAGGGAGGTGG - Intergenic
949188098 3:1218184-1218206 TGGTGGGGTGGCCTGGCAGAGGG + Intronic
949250992 3:1983692-1983714 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
949315746 3:2752757-2752779 AGGTGGGGAAGGGAGGAAGAAGG - Intronic
949958902 3:9295132-9295154 TGATGGGGAAGGCCATCAGATGG - Intronic
950150533 3:10683380-10683402 GGGTTGGGAAGGCAGGAATAGGG + Intronic
950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG + Intergenic
950576057 3:13832753-13832775 TGGAGGGGATGGCAGGGAAAAGG + Intronic
950775126 3:15342687-15342709 TGGAGGGGAAGCCAGGCAAGAGG + Intergenic
951039985 3:17979370-17979392 TGCTGGGGTAGGGAGGCTGAGGG + Intronic
951216949 3:20033989-20034011 TGGGGGGTTAGGCAGGAAGATGG - Intergenic
951746215 3:25980602-25980624 TGGTGCAGAAGGCCAGCAGAAGG - Intergenic
952730524 3:36633514-36633536 TGGTGGGGCAGGCAGGTGAAAGG - Intergenic
952967143 3:38628396-38628418 AGGTGGGCAAGGGAGGCAGTGGG - Intronic
953307014 3:41840856-41840878 AGATGGGGCAGCCAGGCAGAGGG - Intronic
953665833 3:44925839-44925861 TGCTGGGGAAGAGAGGGAGATGG + Exonic
953689536 3:45106379-45106401 TGGTGGGGCAGACAAGGAGAAGG - Intronic
953716150 3:45318644-45318666 TGGCTGGGAAGGCAGAGAGAGGG + Intergenic
953919636 3:46943093-46943115 TGCTGGGGAAGGCAGGCCCTGGG + Intronic
953964470 3:47292664-47292686 GGGAGGCCAAGGCAGGCAGATGG + Intronic
954284888 3:49611896-49611918 GGGAAGAGAAGGCAGGCAGATGG - Intronic
954787329 3:53103617-53103639 GGGTGAGGGAGGAAGGCAGAGGG - Intronic
954884182 3:53857522-53857544 GGGAGGCCAAGGCAGGCAGATGG - Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955155308 3:56411322-56411344 GGGTGAGGCAGGCAAGCAGATGG - Intronic
955367849 3:58326892-58326914 GAGAGGGGAAGGTAGGCAGATGG - Intergenic
955897529 3:63716367-63716389 TGTTTGGGCAGGCAGGAAGAAGG - Intergenic
955961229 3:64343238-64343260 TGGAGGGGCAGGGGGGCAGAGGG - Intronic
956289318 3:67645404-67645426 TGGTTGGAAATGGAGGCAGAAGG - Intronic
956466244 3:69523374-69523396 TGGTGGGGAAGGCTGGTGGTAGG + Intronic
956746020 3:72311484-72311506 GGGTGGGGAAGGAAGAGAGATGG - Intergenic
956882166 3:73521377-73521399 GGGAGGGGTAGGCGGGCAGATGG + Intronic
957886560 3:86295944-86295966 TGCTGGGGTAGGGAGGTAGAAGG - Intergenic
957889711 3:86340709-86340731 TAGTGGGGTGGGGAGGCAGAAGG - Intergenic
958270213 3:91490415-91490437 TGGAGGCTGAGGCAGGCAGATGG + Intergenic
958585598 3:96083088-96083110 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
958720747 3:97839822-97839844 GGGAGGCCAAGGCAGGCAGATGG - Intronic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959391002 3:105773381-105773403 TGGTGGGGAAGGGTGAGAGAGGG + Intronic
960365238 3:116763041-116763063 GGGAGGCCAAGGCAGGCAGATGG + Intronic
961026251 3:123560530-123560552 TGGTGGTGATGGCAGGGGGATGG - Intronic
961032540 3:123619135-123619157 TGCTGCAGAAGGAAGGCAGAGGG - Intronic
961299178 3:125911242-125911264 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
961441862 3:126958144-126958166 GGGTGGGGGAGGAAGGCAGTAGG - Intronic
961442404 3:126960773-126960795 AGGTGGTCAAGGCAGGCAGGCGG + Intergenic
961971620 3:130974334-130974356 TACTTGGGAATGCAGGCAGATGG + Intronic
962337664 3:134550873-134550895 CAGTGGGCAAGGGAGGCAGAGGG + Intronic
962816611 3:139006204-139006226 TGGTGGGGACAGCAGCCAGGAGG - Exonic
962818110 3:139020597-139020619 TGGTGGGGACAGCAGCCAGGAGG - Exonic
962820602 3:139044556-139044578 TGGTGGGGACAGCAGCCAGGAGG - Exonic
962865386 3:139444310-139444332 TGGGTGGGGTGGCAGGCAGAGGG - Intergenic
963214052 3:142724606-142724628 TGGAGAGGAAGGCAGGGAGGAGG - Exonic
963341530 3:144040376-144040398 AGGTGGAGAAGGGTGGCAGAAGG - Intronic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964089582 3:152858342-152858364 TGGAGGGGAAGGAAGCCAGAGGG + Intergenic
964494964 3:157278759-157278781 TGGTGGAGAAGGCAGTGAGTGGG + Intronic
964866859 3:161271745-161271767 TTGTGGGGAAGGCAAACAAATGG + Intergenic
965305275 3:167056940-167056962 TGGTGGTGGAGGCCAGCAGATGG - Intergenic
966255716 3:177914516-177914538 TGGTGGGGCCGCCGGGCAGAGGG + Intergenic
966728014 3:183125661-183125683 TCTTGGGGCAGGGAGGCAGAGGG + Intronic
966931898 3:184680843-184680865 TGGTGGGGGGAGCAGGCAGGAGG + Intronic
966933469 3:184690708-184690730 TGGCTGGGAAGGCTGGCAGCTGG - Intergenic
967807624 3:193729618-193729640 TGGTGGGGAGGGGAGGGACATGG - Intergenic
967870334 3:194224176-194224198 TGGTGTGGAGGGCATGAAGAAGG - Intergenic
968173782 3:196531293-196531315 TGGGCGGGCAGGCAGGCAGGCGG - Intergenic
968319389 3:197751404-197751426 CGGAGGCGGAGGCAGGCAGATGG + Intronic
968574597 4:1359747-1359769 CGGTGGAGGAGGCAGGCAGGCGG - Intronic
968611472 4:1559066-1559088 TCGTGGGGAGGGCAGCCAGCCGG - Intergenic
968873071 4:3251193-3251215 TGGTGAGGAAGGGACGCAGAGGG + Intronic
968943461 4:3651427-3651449 GCGTGGGCAGGGCAGGCAGAGGG + Intergenic
969432563 4:7164384-7164406 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
969439911 4:7210886-7210908 TTTTGGGAAAGGCAGGCAGGGGG + Intronic
969675301 4:8611231-8611253 TGGTGGGTCAGGCAGGCGAAGGG - Intronic
969815876 4:9687096-9687118 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
970468058 4:16347782-16347804 TGATGTTGAAGGCAGGAAGAAGG + Intergenic
970593953 4:17583258-17583280 TGGTGGTGAGGACAGGCTGATGG - Intronic
971932061 4:33097420-33097442 TTGTGAGGAAGGCAGGGAAATGG + Intergenic
972440711 4:39088565-39088587 TGCTGGGGGTGGCAGGGAGATGG + Intronic
972676064 4:41260474-41260496 TGGTGTGGGAGGCAGACAGACGG + Intronic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
972947768 4:44278859-44278881 TATTGGGGAAAGCATGCAGAAGG - Intronic
973554224 4:52066049-52066071 AAGTGGGGAAGCCAGTCAGAAGG - Intronic
974911259 4:68123682-68123704 GGGAGGGGAAGGTAGGCAGTAGG + Intronic
975322090 4:73020032-73020054 TGGTATGGAAAGCAGGCATATGG + Intergenic
975822893 4:78289821-78289843 TGGTGGGGAAGGTGGGGAGGGGG - Intronic
976813899 4:89124645-89124667 GGGTTGGGAAGGCAGACACATGG + Intergenic
977188089 4:93965896-93965918 GGGTGGGGAAGACAGGGGGAAGG - Intergenic
977293867 4:95191527-95191549 TGGTGGGGAGGGTGAGCAGAGGG - Intronic
977867058 4:102041588-102041610 AGGTGGGTAAAGCAGGTAGAGGG + Intronic
978376118 4:108077237-108077259 AGATGGGGCAGCCAGGCAGAGGG - Intronic
978787785 4:112629429-112629451 GGGAGGCCAAGGCAGGCAGACGG + Intronic
981134559 4:141195459-141195481 AGGTGGGGAAAGGAGGAAGAGGG - Intronic
981448712 4:144870871-144870893 AGGAGGCCAAGGCAGGCAGATGG + Intergenic
981448921 4:144873060-144873082 TGGGTGGGAAGGCAGGAATAGGG + Intergenic
981536152 4:145801924-145801946 GGGTGGGGAGGGCAGGAAGGTGG + Intronic
981591334 4:146366078-146366100 TGGTGGGTAGGGAATGCAGATGG - Intronic
981643795 4:146974975-146974997 TGGTGGGGAAGGGAGGAGGGTGG - Intergenic
982161858 4:152578403-152578425 TGGTGGAGAGGGCAGTGAGAGGG - Intergenic
982335294 4:154229977-154229999 TTGTGGGGAAGGCAGAGAGAAGG + Intergenic
982817750 4:159907588-159907610 TGGGAGGCAAGGCAGGCAGATGG - Intergenic
984839144 4:184051991-184052013 AGGTGGGGCAGGGAGACAGATGG + Intergenic
984857234 4:184205683-184205705 TTGTGGGGCAGGCAGCGAGAGGG + Intronic
984897845 4:184557756-184557778 TAGAGGGGAAGGGAGGGAGAGGG + Intergenic
985010111 4:185573614-185573636 TCCTGGGGATGGCAGGAAGATGG + Intergenic
985014377 4:185618212-185618234 GGGAGGCCAAGGCAGGCAGATGG - Intronic
985524536 5:395261-395283 TGGTGCGGAATGCAGACAGAGGG + Intronic
985626211 5:989902-989924 TGGTGAAGAAGGAAGGCAGTTGG - Intergenic
985644215 5:1077508-1077530 AGATGTGGCAGGCAGGCAGAGGG + Intronic
986103352 5:4634528-4634550 TGGAGGGGAAGGCATACACACGG + Intergenic
986690264 5:10307952-10307974 GGGTGGGGTAGGGAGGAAGAGGG + Exonic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987346165 5:16980704-16980726 AGGAGGCTAAGGCAGGCAGATGG + Intergenic
988347367 5:30055795-30055817 TGGTGGGGGAGGTAGACAGTGGG + Intergenic
988596241 5:32593929-32593951 GGGAGGCCAAGGCAGGCAGATGG - Intronic
988857892 5:35247010-35247032 GGGAGGGGAAGGGAGGCAAAAGG + Intergenic
990525814 5:56626361-56626383 TGATGGGGGAGGGTGGCAGAAGG - Intergenic
990733648 5:58836522-58836544 TGTGGGGGAAGGGAGGCACAAGG - Intronic
990768030 5:59209423-59209445 GGGAGGCCAAGGCAGGCAGATGG - Intronic
990982476 5:61614543-61614565 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
991662736 5:68967088-68967110 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
992312129 5:75511604-75511626 TAGTGGGCCAGGCAGGAAGATGG - Intronic
992482372 5:77164779-77164801 TGGTGGGGAAGGGACACAGCAGG + Intergenic
992637345 5:78737483-78737505 GGGAGGCCAAGGCAGGCAGATGG + Intronic
992921507 5:81527326-81527348 TGGTGGAGAAGAAATGCAGATGG + Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
993669810 5:90747028-90747050 TGTTAGGCAAGGAAGGCAGATGG + Intronic
994104757 5:95935076-95935098 TGAAGGGAAAGGCAGGCAGAGGG - Intronic
994211630 5:97093540-97093562 GGGAGGTGGAGGCAGGCAGATGG + Exonic
994674974 5:102809528-102809550 CTGTGTGGAAGGTAGGCAGATGG + Intronic
995131384 5:108633940-108633962 TTCTTGGGAAGGTAGGCAGAAGG - Intergenic
995578612 5:113570339-113570361 GGGAGGCCAAGGCAGGCAGATGG - Intronic
997385381 5:133468172-133468194 GGCTGGGGGAGGCAGGCAGGGGG + Intronic
997390601 5:133511840-133511862 TGGTGGGTGGAGCAGGCAGAAGG + Intronic
997530893 5:134580452-134580474 GGGTGGGGAAGGCAGGACGGCGG - Exonic
998177669 5:139911783-139911805 TGATGAGGGGGGCAGGCAGAAGG - Intronic
998977283 5:147662318-147662340 TTGTGGGGCAGGAAGGGAGAAGG - Intronic
998998102 5:147888691-147888713 TGCTTGGGAAGGAAGGAAGATGG - Intronic
999273770 5:150314615-150314637 TGGTGGCAAAGGCAGGCAGGAGG - Intronic
999935467 5:156481295-156481317 TATTGGGGAAGGCTGGGAGATGG + Intronic
1000091113 5:157930391-157930413 GGGTGGCCAAGGCAGGCAGATGG + Intergenic
1000185239 5:158851884-158851906 GGGTGGGGAGGGGAGGCAGGGGG + Intronic
1000240503 5:159404211-159404233 AGGTGGGGAAGGCTGTCACATGG + Intergenic
1000281987 5:159790071-159790093 TGGGGAGGAAGGCGGGCAGGTGG + Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001080930 5:168666813-168666835 TGGAGGGGAGGGTAGGCAGATGG - Intronic
1001548346 5:172584468-172584490 TGGGGGAGAAGGCAGCAAGAGGG + Intergenic
1001684344 5:173582271-173582293 TGGTGAGAAAGGAAGGGAGAAGG + Intergenic
1001933132 5:175687144-175687166 GGGTGGGGGAGCCAGTCAGAGGG + Intergenic
1001989056 5:176100884-176100906 TGGTGGAGAGGGAAGGCAAATGG - Intronic
1001989675 5:176105896-176105918 TGGTGGAGAGGGAAGGCAAATGG - Intronic
1001989985 5:176108442-176108464 TGGTGGAGAGGGAAGGCAAATGG - Intronic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002226885 5:177729696-177729718 TGGTGGAGAGGGAAGGCAAATGG + Intronic
1002227195 5:177732241-177732263 TGGTGGAGAGGGAAGGCAAATGG + Intronic
1002266949 5:178041530-178041552 TGGTGGAGAGGGAAGGCAAATGG - Intronic
1002431430 5:179206496-179206518 TGGTGTGGAAGCCGGGCAGGTGG - Intronic
1002803768 6:552042-552064 TGCAGGGGAAGGCAGTCAGCTGG - Intronic
1002857948 6:1054995-1055017 GGGTGGAGGAGGCAGGAAGATGG - Intergenic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1002879141 6:1236100-1236122 TGCTGGACAAGGCAGGGAGAAGG - Intergenic
1003094295 6:3130485-3130507 TGGTGGGCCAGGCTGGCAGGTGG - Intronic
1003172074 6:3727736-3727758 TGGAGGAGAAAGCAGGGAGATGG - Intronic
1003582849 6:7358169-7358191 TGGAGGTCAAGGAAGGCAGATGG - Intronic
1003591316 6:7439349-7439371 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1003804840 6:9715469-9715491 TGGTAGGGATGGCAGGAAGGAGG + Intronic
1004215948 6:13704386-13704408 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1004537006 6:16512822-16512844 TGATGGTGATGGCAGGTAGAGGG - Intronic
1005174646 6:23030891-23030913 TGCAGTGGAAGGCAGGGAGATGG + Intergenic
1005260814 6:24057362-24057384 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1006034185 6:31198806-31198828 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1006360883 6:33586448-33586470 TCCTGGGGAAGGCAGGGCGAAGG + Intergenic
1006373565 6:33659607-33659629 GGGTGGAGAAGGCAGGAAGAGGG - Intronic
1006394635 6:33779113-33779135 TGTTGGGGAAGGCAGCCTGGAGG - Intronic
1006544936 6:34772765-34772787 GGGAGGGGAGGGCAGGCAGAGGG - Intronic
1006555561 6:34863144-34863166 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1006855989 6:37133648-37133670 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1007484594 6:42172297-42172319 TGGTGGGGAAAGCAGAAATATGG + Intronic
1007636001 6:43300065-43300087 TGGTGAGGACTGCAGGCAGCTGG + Exonic
1007811052 6:44485909-44485931 TGATGGGGAGGGCAGGGGGAAGG - Intergenic
1008475860 6:51935032-51935054 TGGTGGGGCAGGCAGGGAGATGG - Intronic
1008571926 6:52825078-52825100 TGGAGGCCAAGGCAGGCAGCTGG - Intergenic
1008623925 6:53299409-53299431 TGGTGGGGCAGGAATGGAGAGGG + Intronic
1011410258 6:87059788-87059810 AGGTGGGGGAGGCAGGGAGGAGG + Intergenic
1011573178 6:88762312-88762334 TGGTAGGGAAGGCTGGTTGAAGG - Intronic
1012641401 6:101621211-101621233 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1012936987 6:105378561-105378583 TGGTAGTGAAGGCAGGAAAAGGG + Intronic
1013082637 6:106825554-106825576 TGGTGGAGGAAGCTGGCAGAGGG - Intergenic
1013115580 6:107101323-107101345 GGGTGGGGATGGCAGCAAGAGGG + Intronic
1013355138 6:109339842-109339864 TGGAGAGGAAGGCAGGAGGAGGG - Intergenic
1013465791 6:110415876-110415898 TGGTGGGGGAAGCAGGAAGGAGG + Intergenic
1013699246 6:112743656-112743678 TAGTAGGGAAGACAGGGAGAGGG - Intergenic
1014076304 6:117239055-117239077 GAGAGGGGAAGGCAGTCAGATGG + Intergenic
1014830545 6:126098126-126098148 AGGTAGGGAAGGCAGGGAGGAGG - Intergenic
1015774961 6:136804662-136804684 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1015818338 6:137233525-137233547 GGGAGGGCAAGGCAGGCGGATGG - Intergenic
1016426271 6:143939027-143939049 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1016643958 6:146381635-146381657 TGGTGGGGGAGGCAGACAATCGG + Intronic
1016785355 6:148005512-148005534 AGGAGGGGAAGGAAGGAAGAGGG + Intergenic
1016886085 6:148960548-148960570 GGGTGGGGAAAGCAGGAAAAGGG + Intronic
1016946522 6:149539617-149539639 GCGGGGGCAAGGCAGGCAGATGG - Intronic
1017168592 6:151434086-151434108 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1017203783 6:151783384-151783406 TGCAGGGCAAGACAGGCAGAGGG + Intronic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017441973 6:154473000-154473022 TGGTGATGAAGGAAGGAAGAAGG + Intronic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1017757612 6:157542801-157542823 CAGTGGGGACGGCAGGCCGAGGG + Intronic
1018034705 6:159872043-159872065 GGGTGGTGATGGCAGGAAGATGG + Intergenic
1018128458 6:160705068-160705090 TGGTGGGGGCCGCAGGCAGAGGG - Intronic
1018441096 6:163814100-163814122 TGGTGGGGAAGGGAGGAAAGTGG - Intergenic
1018752900 6:166822612-166822634 TGGTGGGGCAGGCAGGGAATGGG - Intronic
1019092894 6:169554320-169554342 TGATGGTGAATGCAGGAAGACGG + Intronic
1019168437 6:170114985-170115007 TGGTGGGGAATGGAGGCCCAGGG - Intergenic
1019190659 6:170248990-170249012 TGGAGGGGAAGGCAGGCAGCCGG - Intergenic
1019201626 6:170321048-170321070 TGTTGGGGAAGGCAGGGTCAAGG + Intronic
1019294982 7:269284-269306 TGGTGGGAAAGGCAGGGAGGGGG + Intergenic
1019492030 7:1318766-1318788 TGGTGGGGAGTGCAGGTAGGGGG + Intergenic
1019524247 7:1473651-1473673 TGTTGATGAAGGCAGCCAGATGG + Exonic
1019648690 7:2144619-2144641 AGCTGGGGACGCCAGGCAGAGGG + Intronic
1019827920 7:3299961-3299983 TGGTGTGGAAAGGGGGCAGATGG + Intergenic
1020454772 7:8359409-8359431 TGGGAGGGAAGGCAGGCTAAAGG + Intergenic
1021073979 7:16277865-16277887 TGCTGGGGAATGCAGGCATCAGG + Intronic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021979970 7:26044726-26044748 GGGTGGGGAATGCGGGGAGATGG - Intergenic
1022252299 7:28620534-28620556 AGGTAGTGAAGGTAGGCAGAAGG + Intronic
1022506316 7:30910411-30910433 TGGTGGGGCAGGCAGGAGGTGGG + Intergenic
1022798407 7:33751630-33751652 TGGGCGGGATAGCAGGCAGAGGG + Intergenic
1022850518 7:34257005-34257027 TGTTGGGGAAGGCAGGCATTGGG - Intergenic
1022984422 7:35636887-35636909 GGGTGGTCAAGGCAGGCAGATGG + Intronic
1023328208 7:39083601-39083623 AGATGGGGGAGGCAGGCAGAAGG - Intronic
1023377768 7:39575913-39575935 TGTTGGAGAAGGCAAGGAGAAGG - Intronic
1023776446 7:43612236-43612258 TGGAGGGGCATGAAGGCAGAAGG - Intronic
1023781928 7:43663869-43663891 GGGCGGCCAAGGCAGGCAGATGG + Intronic
1023995781 7:45158085-45158107 TGGCGGGCAAGGGAGGCACAGGG + Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1025264436 7:57443261-57443283 TTGTGGGGAAGGGAGGGAGCAGG + Intergenic
1025634769 7:63312844-63312866 TTGTGGGGAAGGGAGGGAGCAGG - Intergenic
1025647926 7:63435326-63435348 TTGTGGGGAAGGGAGGGAGCAGG + Intergenic
1026105749 7:67419379-67419401 TGGTGGGGGAGGCTGGCATGTGG + Intergenic
1026155651 7:67823472-67823494 GGGAGGCCAAGGCAGGCAGAGGG - Intergenic
1026178627 7:68019309-68019331 GGGAGGTGGAGGCAGGCAGATGG + Intergenic
1026552765 7:71381953-71381975 TTGTGGGAAAGAAAGGCAGAGGG + Intronic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1026989000 7:74572660-74572682 GGGTGGGGAAGGCTGAGAGAGGG - Intronic
1027164704 7:75826115-75826137 GGGTGGGGATGGCAGGGAGTTGG - Intergenic
1027165257 7:75829723-75829745 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1027165879 7:75834021-75834043 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1027189450 7:75988809-75988831 TGGAGGGGAAGGCGGGGAGGGGG + Intronic
1027189462 7:75988834-75988856 TGGAGGGGAAGGCGGGGAGGGGG + Intronic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1028117693 7:87019266-87019288 AGGAGGGCAAGGCAGGAAGATGG - Intronic
1028136231 7:87225885-87225907 TTGTAGCTAAGGCAGGCAGAAGG + Intergenic
1028165980 7:87538980-87539002 TGGTGGGCAGTGCAGGCAGAAGG - Intronic
1028440870 7:90859187-90859209 CGGTGGGGAAGGCAATAAGAAGG - Intronic
1028470820 7:91204707-91204729 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1029197268 7:98814297-98814319 TGTTGGGGAAGGGATGCAGAGGG + Intergenic
1029309339 7:99647256-99647278 TGCTGGGGAAGGCATCCACATGG - Intergenic
1029453462 7:100655571-100655593 TGGTGGGGAAGTCAGCCTGGTGG + Exonic
1029538360 7:101168896-101168918 TGGAGGGGCAGGCAGGGAGGGGG + Intergenic
1029707511 7:102283560-102283582 TGGTGGCAAAGGCAGGCTGGGGG - Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031694274 7:124829935-124829957 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1032085916 7:128883930-128883952 TGGTGAGGAAGGGCGGCAGGGGG + Intronic
1032130036 7:129220401-129220423 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1032418090 7:131754215-131754237 TGATGGGTCAGGCAGGCAGCCGG + Intergenic
1032453639 7:132055793-132055815 AGCTGGGGAAGGGAGGCTGAGGG - Intergenic
1032499654 7:132390953-132390975 TGGATGGGAAGGAACGCAGAGGG + Intronic
1033200597 7:139365599-139365621 GGGTTGAGAAGACAGGCAGATGG + Intronic
1033422545 7:141216761-141216783 TGGGTGGGTAGGAAGGCAGATGG - Intronic
1034203427 7:149296231-149296253 TGTTGGAGCAGGCAGGCAAAGGG + Intronic
1034258584 7:149739051-149739073 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1034271788 7:149806658-149806680 GGGAAGGGAAGGGAGGCAGAGGG - Intergenic
1034458846 7:151187029-151187051 TGGTGGAGAAGCCCAGCAGAGGG - Exonic
1034545240 7:151784927-151784949 CGGTGGGAAAGCCAGGCGGAGGG + Intronic
1034862962 7:154615920-154615942 TCCTGGGGAATTCAGGCAGAGGG - Intronic
1034889752 7:154829450-154829472 TGGTGGGGAGGGGAGGGAGGAGG + Intronic
1034979563 7:155467327-155467349 TGGTGGGGAAGGGAAGCCGCCGG + Intergenic
1035122041 7:156576877-156576899 AGGTGGGGAAGACAGACAGCAGG - Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1036176098 8:6539824-6539846 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1036668113 8:10761254-10761276 TGGAGGAGGAGGGAGGCAGAGGG + Intronic
1037466776 8:19168630-19168652 AGGTGGGGAAGGGAAGCAAAAGG + Intergenic
1037750496 8:21679066-21679088 TGAGGTGGAAGGCAGACAGAGGG - Intergenic
1038007517 8:23445271-23445293 TGCTGTGGCAGGCTGGCAGAGGG - Intronic
1038215136 8:25555070-25555092 TGGTGGAGGAGTCAGCCAGATGG - Intergenic
1038261253 8:25997329-25997351 GGGAGGCCAAGGCAGGCAGACGG + Intronic
1038595931 8:28886484-28886506 GGGAGGCGGAGGCAGGCAGATGG - Intronic
1038599548 8:28926057-28926079 GGGAGTGCAAGGCAGGCAGATGG + Intronic
1038665053 8:29530613-29530635 TGGAGGGGACGGCAGGGAGAAGG + Intergenic
1038683376 8:29692257-29692279 GGGTGGGGGAGACAGGAAGATGG + Intergenic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1038958480 8:32492857-32492879 TGGTGGGGAGGGGAGGCTGGGGG + Intronic
1039448271 8:37649649-37649671 TGGTGGGGCTGGGAGGCAGTGGG - Intergenic
1039765310 8:40622338-40622360 TGTTGGAGAAGGCAGGCATTTGG - Intronic
1039771732 8:40694494-40694516 TGTTGGGAAAGCCTGGCAGATGG - Intronic
1040293687 8:46138409-46138431 TGGTTGTTGAGGCAGGCAGAGGG - Intergenic
1040337835 8:46425110-46425132 GGGACGGCAAGGCAGGCAGAGGG + Intergenic
1041119383 8:54570965-54570987 TGGTGGCCTAGGCAGGCAGGAGG + Intergenic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1041315679 8:56559827-56559849 TGGTGGGGAAGTCGGGGAAAGGG - Intergenic
1041904805 8:63020746-63020768 TAGAGGTGAAGGCAGGGAGAGGG + Intronic
1042061998 8:64828962-64828984 TGCTGGTGATGGCAGGAAGAGGG - Intergenic
1042659473 8:71137849-71137871 TGGTGGGTAGGGCAGAAAGAAGG + Intergenic
1042814473 8:72863768-72863790 AGGAGGCCAAGGCAGGCAGATGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043142010 8:76602352-76602374 TGGAGTGGAAGTCAGGCAGGGGG - Intergenic
1043961313 8:86421911-86421933 AGATGGGGAAGGGAGGTAGAAGG + Intronic
1044772671 8:95653675-95653697 TGGTGACAAAGGCAGGGAGAAGG - Intergenic
1045466584 8:102476035-102476057 TGGGAGGTGAGGCAGGCAGATGG - Intergenic
1045631993 8:104135355-104135377 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1045783238 8:105892358-105892380 GGCTGGGGAAGGGAGGAAGAAGG + Intergenic
1047026898 8:120834115-120834137 GGGTGGGGAAGGCGGCCAGGAGG + Intergenic
1047211171 8:122841548-122841570 TGGGGGGCAATCCAGGCAGAGGG + Intronic
1047602821 8:126443696-126443718 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1047718894 8:127620402-127620424 TGGAGGGGAAAGCAGGAAGGAGG + Intergenic
1047772260 8:128038991-128039013 AGGGAGGGAAGGGAGGCAGAAGG + Intergenic
1048202100 8:132383129-132383151 TCATGGGGAAAGCAGGCAAAGGG - Intronic
1048228581 8:132614523-132614545 TGGTGATGAGGGCAGGCAGGAGG + Intronic
1048462078 8:134629326-134629348 TGGTGGTGAAATCAGGCAAATGG + Intronic
1048865867 8:138761106-138761128 TGCAGGGGAAGCCAGGCAGTGGG - Intronic
1048885283 8:138904471-138904493 TGATGGGTGAGGCAGGCTGAGGG - Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049528951 8:143143753-143143775 TGGGCGGGCAGGCGGGCAGATGG + Intergenic
1049659035 8:143811550-143811572 TGGTGGGGACTGAAGGCTGAGGG - Intronic
1049800052 8:144513481-144513503 CTTTGGGGAAGACAGGCAGATGG + Intronic
1049996048 9:1035046-1035068 GGGTGCCCAAGGCAGGCAGATGG - Intergenic
1050150968 9:2619236-2619258 TGGTAGGGGAGGCAGGCAAGTGG - Intergenic
1050303808 9:4286167-4286189 TGGGGCTTAAGGCAGGCAGATGG + Exonic
1050535353 9:6626028-6626050 TTTTGCTGAAGGCAGGCAGAGGG - Intronic
1050860515 9:10423305-10423327 TGGGGTGGAGGGCAGGGAGAGGG + Intronic
1051678678 9:19584055-19584077 TGCTGGGGAAAGCAGGCATGTGG - Intronic
1052274614 9:26663341-26663363 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1052794684 9:32912435-32912457 TGGAGGGGAAGGCAGGGAAGCGG - Intergenic
1053422440 9:37987982-37988004 TGGTTGGGAAGGCTGGCATGTGG - Intronic
1053692106 9:40591805-40591827 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054144343 9:61550949-61550971 TGGTCGGGAGGGCAGACACAGGG + Intergenic
1054272694 9:63045680-63045702 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1054303364 9:63392771-63392793 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054402144 9:64719281-64719303 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054435749 9:65203596-65203618 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054464031 9:65481908-65481930 TGGTCGGGAGGGCAGACACAGGG + Intergenic
1054494644 9:65818091-65818113 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1054649233 9:67612571-67612593 TGGTCGGGAGGGCAGACACAGGG + Intergenic
1055447912 9:76401368-76401390 AGGAGGCCAAGGCAGGCAGATGG - Intergenic
1055555884 9:77473215-77473237 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1055593567 9:77843252-77843274 TCTGGGGGAAGACAGGCAGATGG + Intronic
1056071889 9:82995683-82995705 GGGTAGTCAAGGCAGGCAGATGG - Intronic
1056095284 9:83246898-83246920 TGGTGAGGCTGGCAGGCAAATGG - Exonic
1056766865 9:89449493-89449515 TGGCTGGGAAGGGAGGCAGAGGG + Intronic
1057015297 9:91645666-91645688 TGGTGGGGGAGGCAGAGTGAGGG - Intronic
1057080925 9:92173953-92173975 TGGTGGGACAGGAAGGCACAGGG + Intergenic
1057185467 9:93055226-93055248 TGGTGAGGCAGGCCGGGAGAAGG - Intergenic
1057386450 9:94609585-94609607 TGCTGGGGAAGGAAGGCCGGGGG - Intronic
1057427434 9:94964184-94964206 TGCTGGGGATGGCAGGCCCAGGG - Intronic
1057823693 9:98354927-98354949 TAGTGAGGAAGGCAGGTTGAAGG - Intronic
1057893202 9:98885059-98885081 TGATAGAGAAGTCAGGCAGAGGG - Intergenic
1059354273 9:113687211-113687233 GGGTGGGGAAGGGAGGGAGGAGG + Intergenic
1059402316 9:114078034-114078056 TGATGGGGAGTCCAGGCAGATGG - Intronic
1059657525 9:116369769-116369791 GGATGGGGCAGGCAGGCAGCGGG - Intronic
1060112507 9:120916755-120916777 TTCTATGGAAGGCAGGCAGAGGG + Intronic
1060233236 9:121841048-121841070 TGGCAGGGAGGGCAGGGAGAAGG + Intronic
1060470415 9:123943463-123943485 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1060551097 9:124485836-124485858 TGGTGGGGAGCGAAGGCAGATGG - Intronic
1060569767 9:124627810-124627832 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1060785750 9:126450556-126450578 TGGTGGGGAGGGCATAGAGATGG + Intronic
1060810905 9:126611137-126611159 CAGCGGGGAAGGCATGCAGAGGG + Intergenic
1060879669 9:127109120-127109142 GGCTGGGGAGGGGAGGCAGAGGG + Intronic
1061052769 9:128205886-128205908 GGGTGGAGAGGGCAGCCAGAGGG - Intronic
1061584145 9:131555299-131555321 TGGTAGGGAGGGCAGGAAGGTGG + Intergenic
1062194846 9:135267257-135267279 TGGTGGGGAAGGAAGGTGGTAGG - Intergenic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062282039 9:135756537-135756559 TGGTGGGGAGGGAACGGAGATGG - Intronic
1062497448 9:136838430-136838452 TGGTGGGAGGGGCTGGCAGATGG - Intronic
1062660928 9:137632641-137632663 AGGAGGCCAAGGCAGGCAGATGG - Intronic
1062730847 9:138107646-138107668 TTGTGTTGAAGGCAGACAGAAGG - Intronic
1203622767 Un_KI270749v1:137942-137964 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1186115243 X:6298510-6298532 GGGAGGCCAAGGCAGGCAGAAGG - Intergenic
1186190420 X:7062483-7062505 GGGTGAGAAATGCAGGCAGAGGG + Intronic
1186207219 X:7213456-7213478 CGGTGGGAAAGGCAGGCAGGAGG + Intergenic
1186368891 X:8926405-8926427 TGGTGGGCCAGGTAGGGAGAGGG + Intergenic
1186660040 X:11660319-11660341 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1186751069 X:12621580-12621602 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1186751197 X:12622768-12622790 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1186852444 X:13593612-13593634 TGGTGGGGAAAGCAGGGAGAGGG + Intronic
1187787899 X:22913805-22913827 TGGTGTGGAAAAGAGGCAGAAGG + Intergenic
1187859343 X:23666509-23666531 GGGTGGGGAGGGCAGGGAAAAGG + Intronic
1187931080 X:24294154-24294176 TGGAGGTCAAGGCGGGCAGATGG - Intergenic
1187964156 X:24594230-24594252 TGGGGGGGAAGGTGGGCAGGAGG + Intronic
1189134520 X:38534529-38534551 GGTTGGGGAAGGAAGGTAGAGGG - Intronic
1189840661 X:45073013-45073035 TGGGGTGGAAGGCAGGGGGAGGG - Intronic
1190011167 X:46786274-46786296 TGGTGGGGAAGGCTGATAGTGGG + Intergenic
1190360638 X:49645283-49645305 GTGTGGAGAAGCCAGGCAGAAGG + Intergenic
1190503135 X:51098693-51098715 TTGTCAGGAAGGGAGGCAGAGGG - Intergenic
1190532404 X:51392945-51392967 GGGTGAGGAAGGCATCCAGAAGG - Intergenic
1190859539 X:54330703-54330725 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1190881752 X:54496350-54496372 CTGTGGGGAAAGCAGGCTGAGGG - Intergenic
1192663598 X:73067929-73067951 AGATGGGGCAGCCAGGCAGAGGG - Intergenic
1192762584 X:74109097-74109119 TTGTGGGGAAGGGTGGGAGAGGG + Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1194210746 X:91066295-91066317 TGGAGGGGCTGGCAGGCAGGGGG - Intergenic
1194509702 X:94778530-94778552 TGATGGGGAAAGGAGGCAAATGG + Intergenic
1194861202 X:99000910-99000932 GGGAGGTCAAGGCAGGCAGATGG - Intergenic
1195803675 X:108737983-108738005 TGGTGGGGGAGAGAGGGAGAGGG - Intergenic
1195993269 X:110704599-110704621 TGATGGGGAAGGAAGGCAAAGGG + Intronic
1196433900 X:115657389-115657411 GGGAGGCGGAGGCAGGCAGATGG + Intergenic
1197427457 X:126315063-126315085 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1197433872 X:126400878-126400900 TGGTGGTGAGGGCTGGCAGCAGG + Intergenic
1197607126 X:128597558-128597580 TGGCGGGGAAGGCAAGGGGAAGG - Intergenic
1197614892 X:128680012-128680034 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1197899011 X:131348428-131348450 TTGTGGGGAAGGGATGAAGATGG - Intronic
1198121130 X:133593486-133593508 TGGTGGGAAATGAAGCCAGAAGG + Intronic
1198832888 X:140769792-140769814 TGGAGGAGAAGGCAAGCAGGTGG - Intergenic
1199600181 X:149537018-149537040 TCCTGGGGGAGGCAGGCAGAGGG + Intergenic
1199650402 X:149942922-149942944 TCCTGGGGGAGGCAGGCAGAGGG - Intergenic
1199998146 X:153039838-153039860 TGGAAGGGAAGGAAGGCAAAGGG + Intergenic
1200053476 X:153446621-153446643 TGCTGGGGAAGGAAGGGAGGTGG + Intronic
1200270150 X:154674895-154674917 TGCTGGGGCAGGCAGGCGTAGGG + Intergenic
1201011704 Y:9553253-9553275 TGGTGGGGAAGGAAGAAAGGAGG - Intergenic
1201146420 Y:11067498-11067520 GGGTGAGGAAGGGAGGGAGAGGG + Intergenic
1201176777 Y:11314640-11314662 TGGTGGGGAGGGCGTGCTGATGG - Intergenic
1201190725 Y:11440335-11440357 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1201226469 Y:11823569-11823591 TGGTGAGGGAGGAAGGCAGTGGG + Intergenic