ID: 1148355253

View in Genome Browser
Species Human (GRCh38)
Location 17:46971521-46971543
Sequence CTTGAACCCCACACAGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148355249_1148355253 4 Left 1148355249 17:46971494-46971516 CCTGGCCTAACTATATCCTTTGC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355248_1148355253 9 Left 1148355248 17:46971489-46971511 CCTAGCCTGGCCTAACTATATCC 0: 1
1: 0
2: 1
3: 20
4: 215
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355243_1148355253 21 Left 1148355243 17:46971477-46971499 CCAGTGCCCCACCCTAGCCTGGC 0: 1
1: 0
2: 4
3: 44
4: 477
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355241_1148355253 22 Left 1148355241 17:46971476-46971498 CCCAGTGCCCCACCCTAGCCTGG 0: 1
1: 0
2: 4
3: 40
4: 279
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355247_1148355253 10 Left 1148355247 17:46971488-46971510 CCCTAGCCTGGCCTAACTATATC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355250_1148355253 -1 Left 1148355250 17:46971499-46971521 CCTAACTATATCCTTTGCTGACC 0: 1
1: 0
2: 1
3: 17
4: 121
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355246_1148355253 13 Left 1148355246 17:46971485-46971507 CCACCCTAGCCTGGCCTAACTAT 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355245_1148355253 14 Left 1148355245 17:46971484-46971506 CCCACCCTAGCCTGGCCTAACTA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123
1148355244_1148355253 15 Left 1148355244 17:46971483-46971505 CCCCACCCTAGCCTGGCCTAACT 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148355253 Original CRISPR CTTGAACCCCACACAGATCC TGG Intronic
900142928 1:1145999-1146021 CTGGAACCCCACGCAGTGCCAGG - Intergenic
900921667 1:5675904-5675926 CTTGAACCTCCCACAGAACCAGG - Intergenic
903850418 1:26302486-26302508 ACTGAACCCCACACAGGGCCTGG + Intronic
903880086 1:26502175-26502197 CATGAGCCACACACAGAGCCCGG - Intergenic
906678685 1:47710548-47710570 CTGGAACCCCACGCACCTCCAGG + Intergenic
907677442 1:56531700-56531722 CTTGAAAGCCAAACAGATCTAGG + Intronic
915307606 1:154989632-154989654 GTTGAAGCCCACACAGAGCTGGG - Exonic
915964120 1:160291716-160291738 CTTCATCCCCACTCAGATCTGGG + Intronic
916200731 1:162269044-162269066 CTAGTACCCCAGGCAGATCCAGG + Intronic
920106556 1:203557353-203557375 CTTGCACCCCATACAGTGCCTGG - Intergenic
920121453 1:203661760-203661782 CTGGGAGCCCACACAGAGCCTGG - Intronic
923097650 1:230788357-230788379 ATGGAGCCTCACACAGATCCAGG + Intronic
1062763521 10:45247-45269 CCTGAACCCCCCTCAGACCCAGG + Intergenic
1067055095 10:43045465-43045487 CTTGACCCCCACACAGATGCAGG - Intergenic
1068862015 10:61856845-61856867 CTTGAAACCCACCCAGTCCCAGG - Intergenic
1069987512 10:72294421-72294443 CCTGGACCCCACACAGCACCTGG - Intergenic
1072616301 10:97050866-97050888 CTTGAACCACCCACAGAGACAGG + Intronic
1074185101 10:111094303-111094325 CTCCAACCCCACAAAGAGCCTGG - Intergenic
1074405679 10:113178483-113178505 CGTGAACCCCACTGAGATTCTGG + Intergenic
1076110412 10:127855548-127855570 CTGGAACCACAGACAGTTCCTGG - Intergenic
1076794652 10:132792688-132792710 CTGCACCCCCACACAGTTCCCGG - Intergenic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1076819672 10:132932056-132932078 CCTGCTCCCCACACAGAGCCTGG + Intronic
1083866335 11:65455520-65455542 CTTCCACCCCACACTGACCCAGG - Intergenic
1084547163 11:69820226-69820248 CTTGACCCCCACACAGTCCAGGG - Intergenic
1085790897 11:79496856-79496878 CTAGAACCCCACATAATTCCTGG - Intergenic
1089055152 11:115579335-115579357 CTTGAACCAAACACTGTTCCCGG + Intergenic
1089333291 11:117704995-117705017 TTTGCACCACACACACATCCGGG - Intronic
1090172473 11:124617018-124617040 CTGGGACCCCACACAGACCCTGG + Intronic
1090745361 11:129700929-129700951 CTTGAACCCCAGACAGAGAGAGG + Intergenic
1090767341 11:129887675-129887697 CATGAACCCTGAACAGATCCTGG + Intronic
1091004999 11:131944972-131944994 CATGAAGCCCAAATAGATCCAGG - Intronic
1091290286 11:134435697-134435719 CTTCAACCTCACACAGATCTGGG + Intergenic
1091681348 12:2529445-2529467 CCAGAATCCCATACAGATCCTGG + Intronic
1092349752 12:7746607-7746629 CTGGAACCCAAGACAAATCCAGG + Intronic
1095103517 12:38205511-38205533 CCTGACCCCCACTCAGACCCAGG - Intergenic
1097158391 12:57028863-57028885 CTTGAACCTCACTGAGAACCTGG + Exonic
1097396226 12:59078163-59078185 CTTGAGCCACACACAGATGTGGG - Intergenic
1098140998 12:67450310-67450332 GCTGAAGACCACACAGATCCTGG + Intergenic
1098765155 12:74478885-74478907 CTTAAAATCCACACATATCCTGG - Intergenic
1100783325 12:98052638-98052660 CTTGCTCCCCACACATATCTGGG + Intergenic
1101876066 12:108597668-108597690 CATCACCCTCACACAGATCCTGG + Intronic
1102998065 12:117364852-117364874 CCTGAACCCCAGAGAGGTCCTGG - Intronic
1104462264 12:128965366-128965388 CTTGAACCTCACACAGTTGTTGG - Intronic
1104897214 12:132170373-132170395 CTTGGCCGCCACACACATCCTGG + Intergenic
1114579978 14:23748462-23748484 CTGGGAACCCACAGAGATCCAGG - Intergenic
1117992922 14:61452364-61452386 TTGGAAGCACACACAGATCCAGG - Intronic
1121632279 14:95430205-95430227 CTTGACACCCACATGGATCCTGG + Intronic
1126084952 15:45002752-45002774 CTTTAACCCATCACAGATACTGG - Intergenic
1127464380 15:59229325-59229347 TTTGAAAACCACACAGCTCCGGG - Intronic
1128215031 15:65928663-65928685 CCAGAACCCCACAGAGATGCAGG + Intronic
1132937051 16:2486501-2486523 CCTGACCACCACACACATCCTGG - Intronic
1136907942 16:34119503-34119525 CTTGAACCTCCCACAGAACCAGG - Intergenic
1137479672 16:48841629-48841651 CTTGGAGCCCACACAAATCCAGG - Intergenic
1140232461 16:73128940-73128962 ATTGAACCCCAAAGAGATCCTGG + Intronic
1141754616 16:85982983-85983005 TGTGAACCCAGCACAGATCCTGG + Intergenic
1142344989 16:89548156-89548178 CTTGAACCCCAGAAATACCCAGG + Intronic
1143096369 17:4480622-4480644 CTTTAACCCCACAAAGAGCCTGG - Intronic
1144573647 17:16415945-16415967 CTGGAGCCCCACACAGACCCTGG - Intronic
1144719256 17:17456471-17456493 CGCGAACGCCACACAGACCCAGG - Intergenic
1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG + Intronic
1150983412 17:70169176-70169198 CTGGAGCCCCACACACTTCCCGG - Intronic
1152956430 18:45578-45600 CCTGAACCCCCCTCAGACCCAGG + Intergenic
1155618836 18:27752439-27752461 TTTGAACCCCCCACAGAGTCTGG - Intergenic
1158153235 18:54395363-54395385 CTTGACTCTCAGACAGATCCCGG + Intergenic
1160449571 18:78953054-78953076 CGTGAACCCCCGACAGATCCAGG - Intergenic
1162506434 19:11088557-11088579 CCTGAACCCCACACAGGGCTGGG - Intergenic
1167566698 19:50261459-50261481 CTCCCACCCCTCACAGATCCAGG + Exonic
1167756207 19:51415262-51415284 CTTGAACCCGAGGCAGCTCCAGG + Exonic
1168321345 19:55511838-55511860 CTGGCCCCCCACACTGATCCTGG - Intronic
927040754 2:19228240-19228262 CCTGTAACCCACACAGATTCAGG - Intergenic
928369644 2:30731754-30731776 CTTGGCCCCCACACAGTTCTCGG - Intronic
930568342 2:53051909-53051931 ATTCAACCCCAAACAGAGCCAGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935974745 2:108567167-108567189 CGTAAACCCCACACAGACACTGG - Intronic
936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG + Intergenic
948289358 2:236813829-236813851 CTTGAACCCCACCCAGCACCTGG + Intergenic
948572730 2:238927625-238927647 CCTGCACCCCACACAGAGCCTGG - Intergenic
1169416033 20:5416972-5416994 CTTGAATCCCACACATAGCCTGG + Intergenic
1170005751 20:11667242-11667264 TTGGAACCCCAATCAGATCCTGG - Intergenic
1170941830 20:20854411-20854433 CTACAACAACACACAGATCCAGG - Intergenic
1171772961 20:29340412-29340434 TTTGAACCTCCCACAGAACCAGG + Intergenic
1171815058 20:29778652-29778674 CTTGAACCTCCCACAGAACCAGG + Intergenic
1171903380 20:30878068-30878090 CTTGAACCTCCCACAGAACTAGG - Intergenic
1172149267 20:32779144-32779166 CCTGAACCACAAACAGCTCCAGG - Intronic
1173014179 20:39209871-39209893 CTGGAACCTCACAGAGTTCCTGG + Intergenic
1173126842 20:40345151-40345173 CTTGAAGCCAACACAGCACCAGG - Intergenic
1174779306 20:53373787-53373809 TCTGAAGCCCACTCAGATCCTGG - Intronic
1175910802 20:62404697-62404719 CCTGAACCCCACTCTGTTCCTGG - Intronic
1180318493 22:11299206-11299228 CTTGAACCTCCCACAGAACCAGG + Intergenic
1180336775 22:11584026-11584048 CTTGAACCTCCCACAGAACCAGG - Intergenic
1182311632 22:29412780-29412802 ATTGAGCCCCACACTCATCCTGG + Intronic
1182688705 22:32141055-32141077 ATTGAGCCCCACACTCATCCTGG - Intergenic
1183092507 22:35532480-35532502 CTTGGCCACCACACAGACCCAGG - Intergenic
1183664554 22:39239825-39239847 CTTGAACCCCACCCTCCTCCTGG + Intronic
1184444382 22:44538966-44538988 ATCGAACCCCAGGCAGATCCTGG + Intergenic
949965096 3:9349105-9349127 CTTGAAACCCATACAGTTCCTGG + Intronic
950659464 3:14457927-14457949 CTTGAAGCAAACACAGAGCCAGG - Intronic
951911474 3:27754923-27754945 CTTGAACCCCTTACATATCATGG + Intergenic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
957164498 3:76654530-76654552 CATCAACACCACACAGATCATGG + Intronic
961575536 3:127833066-127833088 CTGGAAGGCCACACAGAACCTGG - Intergenic
961754698 3:129121110-129121132 CTTGAACCCGGCCCAGACCCCGG + Intronic
962016660 3:131447969-131447991 CTTGAACCTCAAACCGATCAGGG + Intergenic
964101268 3:152991195-152991217 CATGAACCAAACAAAGATCCTGG + Intergenic
965841896 3:172915714-172915736 CTTTAGCCACACACAGACCCAGG - Intronic
968711486 4:2122612-2122634 CTTGAACCCCACACACCTGTGGG + Intronic
978611333 4:110544147-110544169 CTTGAACCCCATTAAAATCCTGG + Intronic
981027353 4:140090307-140090329 CATGAAGGCCACACAGGTCCTGG - Intronic
984819477 4:183867758-183867780 CTTGAGCCCAGCACAGAGCCTGG - Intronic
987837139 5:23176328-23176350 CTTCAGCCCCACACTGATCTTGG + Intergenic
997241012 5:132308302-132308324 CTTGTGCCCTACACAGAGCCTGG + Intronic
1001090587 5:168737290-168737312 CTTGGAACCCACACAGTGCCAGG + Intronic
1002377140 5:178796778-178796800 CTGGGACCTCACACAGATGCAGG - Intergenic
1004344040 6:14831765-14831787 CTTGTTCCCCACACTCATCCCGG - Intergenic
1007722191 6:43891608-43891630 CTTGAAAGCCACCCAGAGCCTGG - Intergenic
1009441396 6:63683640-63683662 TTTGAAACTCGCACAGATCCTGG + Intronic
1018748073 6:166778209-166778231 CGTGAGCCCCACACAGAGGCAGG - Intronic
1020070132 7:5221923-5221945 CGTGTACCACACACAAATCCAGG + Intronic
1020591214 7:10139701-10139723 CTTGAACATCAAACAGAACCAGG + Intergenic
1020765917 7:12320883-12320905 CTTGCTCCACACACAGAGCCAGG + Intergenic
1023931399 7:44708619-44708641 CTTGGGCCCCACACACAGCCTGG - Exonic
1024243750 7:47454449-47454471 CTTAGTCCCCACAGAGATCCTGG - Intronic
1025613835 7:63101115-63101137 CTCTAACTACACACAGATCCTGG - Intergenic
1028710232 7:93898790-93898812 ATTTAACCCCACACAGAACGTGG + Intronic
1035444864 7:158933400-158933422 CTTGAGCCCCATGCAGAACCAGG + Intronic
1037419354 8:18685885-18685907 CTTTATCCCCACACAGAGGCAGG - Intronic
1039762929 8:40597446-40597468 GGCGACCCCCACACAGATCCAGG - Intronic
1040276307 8:46015833-46015855 CCTGCACCCGACACAGAGCCTGG + Intergenic
1040496217 8:47967755-47967777 CTTGAGACACACACAGCTCCAGG - Intronic
1049617933 8:143584136-143584158 GTGGAAACCAACACAGATCCTGG + Intronic
1057507840 9:95650805-95650827 CTGGAATCACACACAGTTCCTGG - Intergenic
1057950773 9:99367630-99367652 ATTGAGGCCCACAGAGATCCGGG - Intergenic
1058241125 9:102561623-102561645 CTTGTACCTCACACTCATCCTGG - Intergenic
1059417724 9:114172267-114172289 CTTGACCCCCATATATATCCAGG + Intronic
1062322386 9:135996766-135996788 CCTGAGCCCCACACAGAGGCTGG - Intergenic
1187191073 X:17035532-17035554 CTTGAACCCCAAAAGAATCCGGG - Intronic
1195095904 X:101500961-101500983 GATGAACCCTACAAAGATCCAGG + Intronic
1198115697 X:133542855-133542877 CTTGAATCCAAAACAGACCCTGG + Intronic
1199895191 X:152120248-152120270 CCTTAACCCCTCACAGAACCTGG + Intergenic
1200217032 X:154372416-154372438 CCTGAAGCCCACCCAGACCCAGG - Intronic
1201071958 Y:10155260-10155282 CTTGAACCTCCCACAGAACCAGG - Intergenic