ID: 1148355413

View in Genome Browser
Species Human (GRCh38)
Location 17:46972351-46972373
Sequence GGACTTCTTCCCACTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148355413_1148355425 28 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355425 17:46972402-46972424 AGGGAAGGAGAACCTGGGACAGG 0: 1
1: 0
2: 4
3: 51
4: 498
1148355413_1148355415 -7 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355415 17:46972367-46972389 GAAGTCCCTGCAAGGAGCTCTGG 0: 1
1: 0
2: 3
3: 13
4: 209
1148355413_1148355422 22 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355422 17:46972396-46972418 GCCAAGAGGGAAGGAGAACCTGG 0: 1
1: 1
2: 0
3: 36
4: 399
1148355413_1148355424 23 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355424 17:46972397-46972419 CCAAGAGGGAAGGAGAACCTGGG 0: 1
1: 2
2: 6
3: 24
4: 311
1148355413_1148355421 13 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355421 17:46972387-46972409 TGGCTCTTGGCCAAGAGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 237
1148355413_1148355419 8 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355419 17:46972382-46972404 AGCTCTGGCTCTTGGCCAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 187
1148355413_1148355420 9 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355420 17:46972383-46972405 GCTCTGGCTCTTGGCCAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 162
1148355413_1148355418 0 Left 1148355413 17:46972351-46972373 CCAGCTATAGTGGGAAGAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1148355418 17:46972374-46972396 CTGCAAGGAGCTCTGGCTCTTGG 0: 1
1: 0
2: 8
3: 48
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148355413 Original CRISPR GGACTTCTTCCCACTATAGC TGG (reversed) Intronic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
910275067 1:85440842-85440864 GTATTTCTTCCAACTAAAGCTGG + Intronic
916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG + Intronic
918637974 1:186802326-186802348 GGACTTGTTCTGACTCTAGCAGG - Intergenic
923053201 1:230403476-230403498 GGGCTTCTTCCCTCTCAAGCTGG + Intronic
923330501 1:232919364-232919386 TGACTTGGTGCCACTATAGCAGG + Intergenic
924847978 1:247791820-247791842 GGACAGCTTCCCACAGTAGCAGG + Intergenic
1063206709 10:3838852-3838874 GATCCTCTTCCCACTAAAGCAGG - Intergenic
1065140053 10:22712003-22712025 GCAATTCTTCCCACAGTAGCTGG + Intronic
1070673974 10:78399186-78399208 GGACTTTTTGCCACTTGAGCTGG + Intergenic
1072799969 10:98385887-98385909 GGCCTTCTTTCCTCTATACCTGG + Intronic
1078239040 11:9513528-9513550 GGAAAAATTCCCACTATAGCAGG + Intronic
1081426031 11:42927303-42927325 GGACACCTTCCCACTATACTGGG + Intergenic
1081910408 11:46696475-46696497 GGACCTCTGCCCTCTACAGCTGG - Intronic
1087651532 11:100874214-100874236 AGATTACTTCCCACAATAGCAGG - Intronic
1087960079 11:104337845-104337867 AGATTTCTTCCCACTATGCCCGG - Intergenic
1091437839 12:486629-486651 AGACTTCTCCCCACTCTAGATGG - Intronic
1091923011 12:4320958-4320980 GGATTCCTTCCCTCGATAGCCGG - Intergenic
1098164630 12:67681474-67681496 AAACTTCTTCCCACTTTTGCTGG + Intergenic
1109730081 13:66401387-66401409 GTACTTCTTCACACTGCAGCAGG - Intronic
1110016909 13:70417201-70417223 GGAATTCTTCCTATTATACCTGG + Intergenic
1113778723 13:112963606-112963628 GCAATTCTACCCACAATAGCAGG - Intronic
1114672162 14:24417107-24417129 GGACGTCTTCCTGCTACAGCTGG + Exonic
1114902134 14:27075487-27075509 TGACTTCTTCCTTCTATAGGAGG + Intergenic
1119220532 14:72902941-72902963 GGACTGCTTCCCAAAACAGCTGG - Intergenic
1122282222 14:100630078-100630100 GGACTTCTACTCCCGATAGCAGG + Intergenic
1130723157 15:86409879-86409901 GGATTTCTTCCTCCTATAGGAGG - Intronic
1131115227 15:89791231-89791253 GTCCTTCTTCCCTCTATAGATGG + Intronic
1132411527 15:101581833-101581855 GGCCAACTTTCCACTATAGCAGG + Intergenic
1141298915 16:82795109-82795131 GGACTCCTTCCCACACTATCTGG - Intronic
1148355413 17:46972351-46972373 GGACTTCTTCCCACTATAGCTGG - Intronic
1148701332 17:49588729-49588751 TGACTTCTTCCCATTATGCCAGG - Intergenic
1149917948 17:60629047-60629069 GGTCATCTTCCCACTAAAGAAGG - Intronic
1150318021 17:64186325-64186347 GGTCTGCTTCCCACTAAAGCTGG + Intronic
1159455946 18:68660358-68660380 GTACTTTTTCCCTCTATACCAGG + Intergenic
1164672184 19:30078411-30078433 GGATTTCTTTCCAATATACCAGG - Intergenic
1166236626 19:41461649-41461671 GATATTCTTCCCAGTATAGCAGG - Intergenic
1166875062 19:45891833-45891855 GGACCTGTTTCCACTAAAGCTGG - Intronic
925491580 2:4400973-4400995 GGACTTCTTCCCAGTGTGTCTGG - Intergenic
932131812 2:69194486-69194508 GGACTTCTTCCTACTGTGGCTGG + Intronic
932557152 2:72834525-72834547 GCAGTTCTTCCCACTACAGGTGG + Intergenic
936692642 2:114910885-114910907 TGACTTCTTCCCACTATGCAGGG + Intronic
936973468 2:118196638-118196660 GGTCTTCCTCCTACTATTGCTGG - Intergenic
941064313 2:160883886-160883908 GGACTTCTTCCCACTCTCTTGGG + Intergenic
947369945 2:229435189-229435211 GGGCTTCTTCCCACGATTGTAGG - Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1177686448 21:24443281-24443303 GGACTTCTTCCCTCATTAGTTGG + Intergenic
1179431198 21:41322377-41322399 GGACTTTTTCCCAGTATTACGGG + Intronic
1185313471 22:50169408-50169430 GGTCCCCTTCCCACTATACCAGG - Intergenic
951179513 3:19642638-19642660 GGACTCCCTGGCACTATAGCAGG - Intergenic
953191590 3:40692438-40692460 GGACTTCTTTGCCCTATACCAGG - Intergenic
957982124 3:87524304-87524326 GAACTTTTGCACACTATAGCTGG - Intergenic
961611595 3:128144023-128144045 GGAGTTCTTGCCACTATATCAGG + Intronic
962154349 3:132929788-132929810 AGACATGTTCCCACCATAGCAGG - Intergenic
963054476 3:141174663-141174685 GGACTTCGTCCCACCCTAGAGGG + Intergenic
963070880 3:141304301-141304323 GGACTTCTTCCCCCAGTTGCTGG + Intergenic
968257616 3:197291408-197291430 TGACATTTTACCACTATAGCTGG + Intronic
970461040 4:16275250-16275272 GGAGTTCTTTCCACTATCACAGG + Intergenic
971530729 4:27685271-27685293 GGCTTTCTTTCCACTATACCAGG - Intergenic
974099488 4:57401197-57401219 GGACAGCTTCACACCATAGCAGG + Intergenic
977213004 4:94242937-94242959 GGATTTCTTCCCTCTTTATCAGG + Intronic
986462112 5:7983193-7983215 TGACTTCTTTCCACTCTTGCAGG - Intergenic
993951089 5:94176198-94176220 GGATTACTTCCCACAAGAGCAGG + Intronic
998675652 5:144404853-144404875 GAACTACTCCCCACTTTAGCAGG + Intronic
1000315133 5:160083199-160083221 GTAATTCTTCCCAGTATACCAGG + Intronic
1002347307 5:178557041-178557063 GGACTTCTTGCCCCTAGAACTGG - Intronic
1002458765 5:179362005-179362027 GGACTTCTGCCCTCCAGAGCGGG - Intergenic
1004102245 6:12625596-12625618 GGACTGCTTTCCACAGTAGCTGG - Intergenic
1005054765 6:21719230-21719252 GGACTTCTTCCCTCCAGAACTGG - Intergenic
1005996593 6:30934925-30934947 GGAAGTCTTCCCACTATCTCTGG + Intergenic
1009660570 6:66606051-66606073 GGACTTCTACTCACTAAGGCAGG - Intergenic
1010583453 6:77627854-77627876 GGATTTGTTCCCACTCTACCAGG - Intergenic
1021656699 7:22880607-22880629 GGAATCCCTGCCACTATAGCAGG - Intergenic
1023504014 7:40881317-40881339 GGAATTCTTCCCACTTTAAAGGG - Intergenic
1028699664 7:93762566-93762588 GGGTTTCTTCCCACTAGATCTGG + Intronic
1029215456 7:98945337-98945359 GGACCTCTTCTGACTGTAGCCGG + Intronic
1031536612 7:122941470-122941492 GGAGTTCTTGCTACAATAGCAGG - Intergenic
1032437630 7:131913352-131913374 GGAGCTCTTTCCACTCTAGCTGG - Intergenic
1033530907 7:142263148-142263170 GGTCTTACTTCCACTATAGCAGG + Intergenic
1034738504 7:153451838-153451860 TGTCTTCTTCCCCTTATAGCAGG - Intergenic
1036627356 8:10483154-10483176 AGACTTCTTCCCCATACAGCAGG - Intergenic
1039411923 8:37361986-37362008 GGACTTCTTTCCACAGTGGCTGG - Intergenic
1042175082 8:66030564-66030586 GGAGATCTCCCCACTCTAGCAGG - Intronic
1042249230 8:66739300-66739322 GGATTACTTCCCACAAGAGCAGG - Intronic
1046831743 8:118753839-118753861 GGGCTTCTTCCCAATATGCCAGG - Intergenic
1047028311 8:120848893-120848915 TGCTTTCTTTCCACTATAGCAGG - Intergenic
1050072970 9:1835703-1835725 AGAGGTCTCCCCACTATAGCAGG + Intergenic
1050139111 9:2498912-2498934 GTGCTTCTGCCCAGTATAGCAGG - Intergenic
1051293681 9:15572369-15572391 GATATTCTTCCCACTATACCAGG - Intronic
1056850679 9:90081293-90081315 TTACTTCTTCCCCATATAGCAGG - Intergenic
1057407616 9:94787928-94787950 GTTGTTCTTCCCACTATGGCAGG + Intronic
1058607666 9:106740943-106740965 GTTCTTCATCCCACAATAGCTGG - Intergenic
1059412059 9:114138689-114138711 GGACTGCTGCCCATCATAGCTGG + Intergenic
1059890556 9:118797204-118797226 GGCCTTCTTTCCACTAAAGAAGG - Intergenic
1188321459 X:28743210-28743232 TGTTTTCTTCCCACTATACCTGG + Intronic
1189868241 X:45353764-45353786 GGACTTCTTCCAACCAGAACTGG + Intergenic
1198598012 X:138258201-138258223 GGATTCCTTCTCTCTATAGCTGG - Intergenic
1198874531 X:141209072-141209094 GGACTCCTACCCACCATTGCTGG + Intergenic