ID: 1148356850

View in Genome Browser
Species Human (GRCh38)
Location 17:46980998-46981020
Sequence TAGCGAAGGGGGGTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 708}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148356833_1148356850 24 Left 1148356833 17:46980951-46980973 CCCCACCCCCAACATTGTTATCA 0: 1
1: 1
2: 6
3: 48
4: 367
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356836_1148356850 19 Left 1148356836 17:46980956-46980978 CCCCCAACATTGTTATCATTATT 0: 1
1: 1
2: 7
3: 68
4: 619
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356837_1148356850 18 Left 1148356837 17:46980957-46980979 CCCCAACATTGTTATCATTATTT 0: 1
1: 1
2: 6
3: 47
4: 658
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356834_1148356850 23 Left 1148356834 17:46980952-46980974 CCCACCCCCAACATTGTTATCAT 0: 1
1: 0
2: 4
3: 16
4: 250
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356839_1148356850 16 Left 1148356839 17:46980959-46980981 CCAACATTGTTATCATTATTTTA 0: 1
1: 0
2: 9
3: 68
4: 804
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356835_1148356850 22 Left 1148356835 17:46980953-46980975 CCACCCCCAACATTGTTATCATT 0: 1
1: 0
2: 3
3: 26
4: 275
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708
1148356838_1148356850 17 Left 1148356838 17:46980958-46980980 CCCAACATTGTTATCATTATTTT 0: 1
1: 1
2: 12
3: 130
4: 1244
Right 1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG 0: 1
1: 1
2: 2
3: 54
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148356850 Original CRISPR TAGCGAAGGGGGGTGGGGGC AGG Intronic
900009330 1:91464-91486 CAGGGATGCGGGGTGGGGGCAGG + Intergenic
900117614 1:1035163-1035185 TAGCGGTGGGGGGGGGGGGGTGG + Intronic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900401847 1:2475950-2475972 TAGGGATGCGGGGTGAGGGCAGG + Intronic
900438112 1:2641026-2641048 CAGGGAAGGGGGGTGTGGGGAGG + Intronic
900880556 1:5378211-5378233 AGGCGATGGGGGGTGGGGGTTGG - Intergenic
900991853 1:6101734-6101756 TTTAGAATGGGGGTGGGGGCTGG - Intergenic
901032959 1:6319026-6319048 CAGTGAATGGGGTTGGGGGCTGG - Intronic
901086079 1:6613351-6613373 TTGCGAAGGGCGGCGGCGGCTGG - Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901728847 1:11263299-11263321 TAGAGACGGGGGGTGCGGGTGGG - Intergenic
901751598 1:11413553-11413575 TGGCGGAGGGGGCTGGGGGAGGG - Intergenic
901835648 1:11922538-11922560 TGGCGAGGGGGGGTGAGGCCTGG - Intronic
901916579 1:12504932-12504954 TGGCGCTGGGGGCTGGGGGCTGG + Intronic
902797211 1:18807566-18807588 GAGTGATGGGGGGTGGGGGTGGG - Intergenic
903185937 1:21629110-21629132 TAGCGAATGGGGGATGGAGCTGG + Intronic
903225529 1:21892458-21892480 GAACGAAGCGGGGTGGGGTCAGG - Intronic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
904039744 1:27576948-27576970 TGGCGTTGGGGGGTGTGGGCAGG - Intronic
904566377 1:31430914-31430936 TAGCCCAGGGGCCTGGGGGCAGG - Intronic
905179379 1:36156760-36156782 TCGGGAAGGGACGTGGGGGCGGG - Intronic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
906117236 1:43365050-43365072 TAGCGAAGGGGAGGGATGGCTGG - Intronic
906527133 1:46500539-46500561 TGGGGGAGGGGGGTAGGGGCTGG - Intergenic
906698847 1:47843068-47843090 TAGTGAAAGGGGGTGGAGGAGGG + Intronic
906972444 1:50530490-50530512 TTGGGAAGGGTGGTGGGGGGAGG + Intronic
907038375 1:51236496-51236518 CAGCGATGGGGGGGGGGGGGCGG - Exonic
907188963 1:52633135-52633157 GAGCGCAGTGGGGAGGGGGCAGG + Intergenic
907364435 1:53946719-53946741 TGGCGTAGGGGTGCGGGGGCAGG + Intronic
907462161 1:54611570-54611592 TTGGGAAGGGTGGTGTGGGCTGG - Intronic
907800512 1:57760543-57760565 TAGAGAAGGGAGGAGAGGGCAGG - Intronic
908148060 1:61268407-61268429 TGGTGTCGGGGGGTGGGGGCAGG - Intronic
908455185 1:64296672-64296694 TAGCGTATGGGGGTGGAGGCAGG - Intergenic
908523569 1:64966701-64966723 GAGCGAAGCCGGATGGGGGCGGG - Intergenic
909944754 1:81650900-81650922 TAGAAAATGGAGGTGGGGGCAGG - Intronic
910388006 1:86705179-86705201 AAGCGAGGCGGGGTGGGGACGGG + Intronic
910423653 1:87098215-87098237 TAGAGACTGGGGGTGGGGGTGGG + Intronic
910509894 1:87991918-87991940 TTGCCAAGGAGGGTGGGGTCTGG - Intergenic
911428755 1:97756336-97756358 TAGCGCAGGGTGGTGGGAGCAGG + Intronic
911681061 1:100716276-100716298 TAGAGTAGGGGGCTGGGGGAGGG - Intergenic
911820320 1:102411272-102411294 AGGAGAAGGGGGGTGGGGGGAGG + Intergenic
912957386 1:114165091-114165113 TAGCCAGGGGAGGTGGGGGGTGG + Intergenic
914196070 1:145448730-145448752 TAGGGAAGGAGAGTGGGAGCCGG - Intergenic
914242076 1:145858941-145858963 TGGGGATGGGGGGAGGGGGCCGG + Intronic
914662919 1:149807508-149807530 TGGCGGGGGGGGGGGGGGGCGGG + Intronic
914815259 1:151058361-151058383 TAGCGCAGGGCAGTGGGGGATGG + Exonic
914825916 1:151138010-151138032 TGGCGGAGCGGAGTGGGGGCTGG + Exonic
915335122 1:155136411-155136433 TACCAGAGGGAGGTGGGGGCGGG + Intronic
915601795 1:156927280-156927302 CAGAGAAAGGGGGTGAGGGCAGG - Intronic
916208502 1:162338681-162338703 TAGCTAAGCAGGGTGGGGTCTGG + Intronic
916706630 1:167357370-167357392 AAGCGGGGGGGGGTGGGGGGGGG - Intronic
917713781 1:177712935-177712957 TAGTGAACTGGGATGGGGGCTGG - Intergenic
917806450 1:178618152-178618174 GAGCAGAGGTGGGTGGGGGCTGG + Intergenic
918643349 1:186871649-186871671 TAGATAACGGAGGTGGGGGCTGG + Intronic
919712061 1:200738816-200738838 GAGGGAAGCGGGGAGGGGGCGGG + Intergenic
919770440 1:201154942-201154964 TGGCGATGGGTGGTGTGGGCTGG + Intronic
919857472 1:201715547-201715569 TAGAGAATGAGGCTGGGGGCAGG + Intronic
919950603 1:202359672-202359694 TGGCGGTGGGGGGTGGGGGTGGG + Intronic
919999484 1:202786178-202786200 AAGAGACGGGGGGTGGGGGGGGG + Intronic
920214358 1:204351352-204351374 TAGAGAAGGTGGGAGGGGTCGGG - Intronic
920227919 1:204451254-204451276 TAGCAAAGGGGAGAGGGAGCTGG + Intronic
920370627 1:205477351-205477373 TAGGGGTGGGGGATGGGGGCAGG - Intergenic
920437201 1:205955062-205955084 TAGCCCATGGGGCTGGGGGCAGG - Intergenic
921167667 1:212518571-212518593 TAGCTGAGGGAGGAGGGGGCAGG + Intergenic
921735727 1:218625723-218625745 TAGAAATGGGGGGTGGGGGTGGG + Intergenic
922051652 1:221996061-221996083 TAGCCAGGTGTGGTGGGGGCGGG + Intergenic
922242073 1:223762085-223762107 TAGAGAAGGGGAGTGGGAGGTGG + Intronic
922362988 1:224840026-224840048 GAGCGAAGGGAGATAGGGGCGGG + Intergenic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
922808435 1:228402425-228402447 TTGCAAAGGGGGGTGAGGCCTGG - Intronic
922819188 1:228472138-228472160 TGGTGAAGTGGGGTGGGGGCTGG - Intergenic
923125634 1:231032383-231032405 TGGGGGTGGGGGGTGGGGGCTGG - Intronic
923649339 1:235858860-235858882 CAGGGAAGGGGAGTGGGAGCAGG + Intronic
924091686 1:240507778-240507800 CAGAGAAGGAGGGTGGGGGTGGG + Intronic
924143067 1:241046298-241046320 TAGAAAAGGGGGGGGGGGTCAGG - Intronic
924524299 1:244833127-244833149 TAGAGACGGGAGGTGGGGGATGG - Intergenic
924803866 1:247347578-247347600 GAGCGGGGGGGGGGGGGGGCGGG - Intergenic
1062824611 10:558491-558513 TAGATACGGGGGGTGGAGGCGGG + Intronic
1062930489 10:1349297-1349319 CAGCGAAGGGAGGTAGGGGTGGG - Intronic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1063807002 10:9656805-9656827 TGGGAAAGGGGGGTGGTGGCAGG - Intergenic
1064059670 10:12127558-12127580 AAGCGGCGGGGGGTGGGGGGGGG - Intergenic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1065111602 10:22445327-22445349 AAACGCAGGGTGGTGGGGGCGGG - Intronic
1065214791 10:23439237-23439259 CAGCGCAGGGGGGCGGGGACGGG - Intergenic
1066278178 10:33889051-33889073 TAGCGGGGGGCGGTGGGGTCGGG - Intergenic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1066520219 10:36209392-36209414 TTGGGTGGGGGGGTGGGGGCGGG + Intergenic
1067913742 10:50374434-50374456 TAGATAATGGGGGTGGGGGTGGG - Intronic
1068610643 10:59056571-59056593 CATGGACGGGGGGTGGGGGCGGG - Intergenic
1068854576 10:61784416-61784438 TGGGGGAGGGGCGTGGGGGCAGG - Intergenic
1069515228 10:69072007-69072029 TAAAGAAGTGGGGTGGGGGGGGG + Intergenic
1069566677 10:69468107-69468129 TGGGGGAGGGGGGCGGGGGCTGG - Intronic
1069976396 10:72216477-72216499 TAACGGGGGGGGGGGGGGGCGGG - Intronic
1069981469 10:72255580-72255602 TAAGGAGGTGGGGTGGGGGCTGG - Intergenic
1070749323 10:78954665-78954687 TAGCGAAGAGGGGTCTGGGAAGG + Intergenic
1070756062 10:78993993-78994015 AATCAAAGGGGGTTGGGGGCAGG - Intergenic
1070769109 10:79071957-79071979 CAGTGACTGGGGGTGGGGGCTGG + Intronic
1071770132 10:88720045-88720067 TAGCTAGAGGGGTTGGGGGCAGG + Intergenic
1072654585 10:97320944-97320966 TGGGGAAAGGAGGTGGGGGCGGG + Exonic
1072735941 10:97879841-97879863 AAGAGAAAGGGGGTGGGGACGGG + Intronic
1073049117 10:100656437-100656459 AAGCTCCGGGGGGTGGGGGCTGG - Intergenic
1073053405 10:100683957-100683979 TAGGGACGGGGGGAGGGGGGAGG + Intergenic
1073112324 10:101070086-101070108 TGGGGAAGGGAGGTGGGGGTGGG - Intergenic
1073135303 10:101216906-101216928 AAGGCAAGGGGGGTGGGTGCTGG + Intergenic
1073288554 10:102402384-102402406 CCGGGAAGGGGGCTGGGGGCAGG - Exonic
1073709651 10:106022142-106022164 TAGAGAAAAGGGGTGGGGGTGGG + Intergenic
1074161308 10:110838642-110838664 TGGGGATGGGGGGTGGGGGAAGG - Exonic
1074192273 10:111148363-111148385 TAGTGAGGGGGGATGGGGGATGG + Intergenic
1074553051 10:114463070-114463092 TCGGAAAGGGGGGTTGGGGCGGG + Intronic
1074967744 10:118507258-118507280 TAGCTACTGGGGGTGGGGGGGGG + Intergenic
1074977245 10:118591693-118591715 TCGGGGTGGGGGGTGGGGGCGGG - Exonic
1075502562 10:122989172-122989194 TAGAGATGGGGGGCGGGGGGTGG + Intronic
1076447785 10:130529963-130529985 TACCGAAGTGGGGTGGGAGGCGG + Intergenic
1076795362 10:132795500-132795522 TAGTGGGGAGGGGTGGGGGCTGG + Intergenic
1077231552 11:1460089-1460111 GAGGGAAGGGGGGTGGGGCAGGG + Intronic
1077233457 11:1468849-1468871 TAGCTAAGGGGGATGGGGGGGGG + Intergenic
1077252132 11:1565369-1565391 TAGGGAAGGGTGCTGCGGGCGGG + Intronic
1077442278 11:2574380-2574402 TAGCAACAGGGGCTGGGGGCTGG + Intronic
1078039335 11:7844018-7844040 TAGGGTAGGGGGCTGGGGGAGGG + Intergenic
1078531614 11:12140870-12140892 TAGAGAAGGTTGGTGGGGGAAGG - Intronic
1078579767 11:12529315-12529337 TAGGGAAGGGCGGAGGGGGGTGG + Exonic
1079181714 11:18199842-18199864 TTGGGAAGGGGGATGGGTGCGGG - Intronic
1079642977 11:22829844-22829866 CAGTGGAGGGCGGTGGGGGCGGG - Exonic
1079645913 11:22863647-22863669 TGGCGGAGGGAGGTGGGGGGTGG + Intergenic
1080165098 11:29226326-29226348 TAGTGACTGGGGGTGGGGGGTGG + Intergenic
1080320056 11:30997996-30998018 AAAAGAAAGGGGGTGGGGGCAGG + Intronic
1080697917 11:34619303-34619325 TGGTGAAGGGGGGTGGGTGGCGG - Intergenic
1081199998 11:40204097-40204119 TAGAGATGGGTGGTGGGGGGCGG + Intronic
1081538521 11:44013462-44013484 TAGAGATGGGGGGTGGAGGGGGG + Intergenic
1081990667 11:47335845-47335867 TGGGGAGGGGGGTTGGGGGCGGG + Intronic
1083142593 11:60734069-60734091 TAGAGATGGCGGGTGGGGGGAGG - Intronic
1084073885 11:66757039-66757061 CGGCGGTGGGGGGTGGGGGCGGG + Intronic
1084121393 11:67071086-67071108 TAGCCAAGTGGTGTGGTGGCGGG + Intronic
1084587346 11:70070259-70070281 TAGCCAAGGAGGGTGAGGGGAGG + Intergenic
1084653589 11:70502732-70502754 TGGGGGGGGGGGGTGGGGGCGGG - Intronic
1084665341 11:70573313-70573335 CAGCGGTGGGGGGGGGGGGCGGG + Intronic
1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG + Intronic
1085346258 11:75769729-75769751 TAGGTAAGGGAGGTGGGGGTTGG - Intronic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1085946484 11:81278975-81278997 TAGAGATGGGGGATGGGGGAAGG - Intergenic
1086371094 11:86156542-86156564 TAGGGCTGGGGGCTGGGGGCTGG - Intergenic
1086921683 11:92594775-92594797 TAGGAAATGGGGGTGGGTGCTGG - Intronic
1089335208 11:117718223-117718245 TCGGGAAGGGGGGTGGGGGATGG - Intronic
1089346559 11:117795296-117795318 TTGCGAAAGGGGATGGGGGTTGG + Intronic
1089572455 11:119419528-119419550 AAGAGAAGGGGGCCGGGGGCAGG + Intronic
1089581876 11:119486538-119486560 TAGGGGAGGGGGGTAGGCGCTGG + Intergenic
1089633478 11:119797580-119797602 CAGCTAAGGGGTCTGGGGGCTGG - Intergenic
1091048477 11:132347213-132347235 TAGCGGGGGGGGGGGGGGGCGGG - Intergenic
1091407940 12:220695-220717 TTGGGAAGCTGGGTGGGGGCTGG - Exonic
1091518967 12:1216609-1216631 GAGGGATGGGGGGTGGGGGGCGG + Intronic
1091770948 12:3150990-3151012 TAGCGAAGCTGGCTGGAGGCTGG - Intronic
1092232373 12:6783280-6783302 CTGCAAAGGGGGCTGGGGGCAGG - Intergenic
1092367681 12:7890671-7890693 AAGGGAAGGGGGTTGGTGGCTGG - Intronic
1092381050 12:7997486-7997508 TAGTGCTGGGGGGTGGGGGGTGG - Intergenic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1093046323 12:14449565-14449587 TAGCCAAGGGGGCGGGGGGTGGG - Intronic
1093633617 12:21438433-21438455 TAACAAAGGGGGCTGAGGGCCGG - Intronic
1094366522 12:29688812-29688834 TAGGGGAGGGGGTTGGGGGTTGG - Intronic
1095919361 12:47514023-47514045 CAGCAAATGGGGGTGGGTGCTGG - Intergenic
1096032372 12:48431144-48431166 TGGGGAAGGGTGGTGGGGGAGGG + Intergenic
1096214890 12:49793301-49793323 GTGGGTAGGGGGGTGGGGGCAGG + Intronic
1097034359 12:56113006-56113028 TGGGGAACTGGGGTGGGGGCAGG - Exonic
1097166188 12:57087838-57087860 AAAGGAGGGGGGGTGGGGGCCGG - Intronic
1097655426 12:62355969-62355991 AAGAAAAAGGGGGTGGGGGCAGG - Intronic
1097896163 12:64825881-64825903 TGGCGCTGGGGGGCGGGGGCCGG - Intronic
1098105817 12:67068850-67068872 TTGCGGGGGGGGGGGGGGGCGGG - Intergenic
1098929744 12:76397342-76397364 TGGGGAGGGGGGGTGGGGGCAGG + Intronic
1099224312 12:79950781-79950803 TTTTGTAGGGGGGTGGGGGCAGG + Intergenic
1099643583 12:85321808-85321830 TTGCTTATGGGGGTGGGGGCTGG - Intergenic
1099955963 12:89352969-89352991 TAAAGAAGGGGGGTTGGGGGAGG - Exonic
1100315167 12:93438566-93438588 TAGCTAAGGGGTGGGGGGGAAGG + Intronic
1101640796 12:106584613-106584635 TATGGAAGTGGGGTGGGGGCTGG + Intronic
1101713289 12:107288477-107288499 TAGAGATTGGCGGTGGGGGCGGG - Intergenic
1102884702 12:116512700-116512722 TTAGGAAGGGTGGTGGGGGCTGG + Intergenic
1105445152 13:20447508-20447530 TAGGGAGGGGGGGTGGTGGAAGG - Intronic
1106028483 13:25977032-25977054 CAGGGAAGGGGGGTGGGGGTGGG - Intronic
1106032064 13:26012724-26012746 TGCTGACGGGGGGTGGGGGCGGG + Intronic
1106227978 13:27799355-27799377 AAGAGAAGGGTGGTGGTGGCGGG + Intergenic
1107772648 13:43805638-43805660 TACCGGTGGGGGGTGGGGGGTGG - Intergenic
1108409347 13:50131146-50131168 AAGGGATGGGGGATGGGGGCGGG - Intronic
1108612078 13:52094093-52094115 TTGGGAAGGGTGGTGAGGGCTGG - Intronic
1110251834 13:73389126-73389148 TAACAAAAGGGGGTGGGGGAAGG - Intergenic
1110527433 13:76555253-76555275 GAGGGAAGGGTGCTGGGGGCAGG + Intergenic
1112560250 13:100506371-100506393 TCGCGGGCGGGGGTGGGGGCGGG + Intronic
1115295577 14:31822031-31822053 TAGGGAAGGGTAGTGGGGTCGGG + Intronic
1115638585 14:35315653-35315675 TAGGGGTGAGGGGTGGGGGCAGG + Intronic
1116821831 14:49634386-49634408 TAGCGAGGCTCGGTGGGGGCGGG + Exonic
1118615558 14:67572384-67572406 TAGAGCTGGGGGATGGGGGCAGG + Intronic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1118975599 14:70673574-70673596 TTGGGAATGGGGGTGGGGGTGGG - Exonic
1119031602 14:71197095-71197117 TGGCGGAGGTGGGTGGGTGCAGG + Intergenic
1119156981 14:72420526-72420548 TAAAGGATGGGGGTGGGGGCAGG - Intronic
1119364927 14:74083897-74083919 TAGTGAAGTAGGGTGGGGGAAGG + Intronic
1119779670 14:77269808-77269830 CAGCGCAGGGGGGGGGGGGGGGG - Intronic
1121562004 14:94882818-94882840 CAGGCAAGGGTGGTGGGGGCGGG - Intergenic
1122016348 14:98800093-98800115 CAGCCAAGGGGAGTGGGGCCAGG - Intergenic
1122123235 14:99565698-99565720 TAGGCAGGTGGGGTGGGGGCCGG - Intronic
1122497182 14:102166102-102166124 GTGAGAAGGGGGGTGGGGGATGG - Intronic
1122556630 14:102584062-102584084 TAGGGACCGGGGGTGGGGGTGGG + Intergenic
1122618569 14:103038709-103038731 TAGAGACGGGGGGGGGGGGCGGG + Intronic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122875146 14:104660480-104660502 AAGTGCAGGGGGGTGGGGGCAGG - Intergenic
1124135862 15:27035810-27035832 TGGAGAATGGCGGTGGGGGCTGG + Intronic
1124378431 15:29143553-29143575 CAGAGAAGGGCCGTGGGGGCTGG + Intronic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1125832604 15:42727568-42727590 CAGAGCAGGGGGGTGGGAGCAGG + Intronic
1127772605 15:62243582-62243604 TGGCCAAGAAGGGTGGGGGCGGG - Intergenic
1128254131 15:66184782-66184804 AAGAGAAGGGGGTTGGGGGTGGG - Intronic
1128484451 15:68071211-68071233 GAGGGAAGGGAGGTAGGGGCGGG - Intronic
1128569049 15:68720067-68720089 CAGGGAATGGGGGTGTGGGCTGG - Intronic
1128661774 15:69506593-69506615 TAGAGAAGAAGGCTGGGGGCTGG - Intergenic
1128944413 15:71811282-71811304 CAAGGAATGGGGGTGGGGGCTGG + Intronic
1129092740 15:73168366-73168388 TAGAGACGGGGGGTGGGGGGGGG + Intronic
1129121689 15:73401268-73401290 TAGGGAAGGGGGTTAGGGGAGGG + Intergenic
1129225757 15:74169509-74169531 GAGCAAAGGGGGGTGAGGCCAGG + Intergenic
1130161339 15:81403672-81403694 GGGAGACGGGGGGTGGGGGCGGG + Intergenic
1130527039 15:84716230-84716252 CAGCGAAGGGGCGCGGGGGGCGG - Intronic
1130538425 15:84803227-84803249 TAGCCAAGAGGAGTAGGGGCTGG - Exonic
1131168483 15:90159868-90159890 TAGGGACGGGGGGTTGGGGGGGG + Intergenic
1131214854 15:90529001-90529023 TAGCAATGGGGGGCGGGGGTGGG - Intergenic
1132646313 16:1000830-1000852 TGGCGGGGGGGGGTGGCGGCCGG + Intergenic
1132934790 16:2474910-2474932 AAGCCAAGGGGGGCGGGGGGTGG - Intergenic
1133069418 16:3235621-3235643 GAGAGTAGGGGGGTGGGGGGTGG - Intronic
1133069457 16:3235689-3235711 GAGAGTAGGGGGGTGGGGGTTGG - Intronic
1133121742 16:3612572-3612594 TAGAGACGGGCGGTGGGGGCGGG + Intronic
1133217860 16:4304318-4304340 GAACCAACGGGGGTGGGGGCGGG + Intergenic
1133757928 16:8776510-8776532 GAGCCATGGGTGGTGGGGGCGGG - Intronic
1133770467 16:8864721-8864743 GAGCCCAGGGTGGTGGGGGCAGG + Intronic
1133996642 16:10753411-10753433 GAGCGATGTGGGCTGGGGGCAGG + Intronic
1134186032 16:12085621-12085643 TAGAGAAGTAGGGTGGGGGCTGG - Intronic
1134690977 16:16190906-16190928 TGGGGGTGGGGGGTGGGGGCTGG + Intronic
1135040334 16:19113371-19113393 TAGAGATGGGGGGCGGGGGGGGG + Intergenic
1135222479 16:20624861-20624883 TAGCCAGGTGTGGTGGGGGCAGG - Intronic
1135417396 16:22279026-22279048 TAGAGAAGTGGATTGGGGGCGGG - Intronic
1136365087 16:29806197-29806219 GTGGGCAGGGGGGTGGGGGCGGG - Intronic
1137536071 16:49327231-49327253 TAGCCAAGGGGTGAGGGAGCTGG - Intergenic
1137765864 16:50977261-50977283 TCGCGGCGGGGGGAGGGGGCAGG - Intergenic
1138160396 16:54747785-54747807 TGGCGGGGGGGGGGGGGGGCGGG - Intergenic
1138178191 16:54922577-54922599 TAGCGTTGGGGGTTGGGGGAAGG + Intergenic
1139511868 16:67432253-67432275 AGGGGAAGGGGGGGGGGGGCTGG + Intronic
1139515568 16:67450531-67450553 TAGCTAGGGGGGCTGGGGGGTGG + Intronic
1139551176 16:67673972-67673994 AGGCGGCGGGGGGTGGGGGCGGG - Intergenic
1139652257 16:68368322-68368344 GAGCTAAGGGTGGCGGGGGCAGG + Intronic
1139851339 16:69952782-69952804 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139880316 16:70175694-70175716 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1140063654 16:71592028-71592050 TAGCGGGGGGGGGGGGGGGGGGG - Intergenic
1140264672 16:73409982-73410004 TGGGGCAGGGGGGTGGGTGCAGG + Intergenic
1140372194 16:74419823-74419845 CAGGGCAGGGTGGTGGGGGCGGG - Intronic
1140424543 16:74849732-74849754 GAGCGAAGTGGAGTGGGGGAGGG + Intergenic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141615801 16:85208752-85208774 TAGCGGATGGGGGTGGGGGTGGG + Intergenic
1141685395 16:85567055-85567077 GGGCGGAGGGGGGTGGGGGTGGG - Intergenic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1141927503 16:87178993-87179015 GGGGGAAGGGGGGTGGGGGTGGG - Intronic
1142018664 16:87766251-87766273 TAGCGACTGGGGGTGGGGGGTGG - Intergenic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142147716 16:88499498-88499520 CAGCGAAGGGGCCAGGGGGCAGG + Intronic
1142687388 17:1585563-1585585 TAGAGACGGGGAGTGGGGGCTGG + Intronic
1142727808 17:1829574-1829596 TGGCGGTGGGGGGTGGGGGTGGG - Intronic
1142799665 17:2337425-2337447 CAGCGACGGGGGATCGGGGCGGG - Exonic
1143154584 17:4828049-4828071 TAGTGAGGGGGGGTGGGCGGTGG + Intergenic
1143201383 17:5115931-5115953 TAGCGCCGGGGGATCGGGGCGGG + Intronic
1143216278 17:5227575-5227597 GAGAGAAGGGGCTTGGGGGCAGG + Intronic
1143750569 17:9023739-9023761 TGGGAAAGGGGGGTGGGTGCAGG - Intronic
1144068162 17:11642391-11642413 TAGCCAGGTGTGGTGGGGGCAGG + Intronic
1144573751 17:16416333-16416355 TGGAGAAGGGGGCAGGGGGCAGG - Intronic
1145982380 17:29020552-29020574 TGGGGCAGGGGGGTGGGGGCTGG + Intronic
1146064695 17:29625028-29625050 AAGAGAAGGAGGGTGGGGGTAGG - Intergenic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1146672740 17:34753008-34753030 TAGCGAAGAGGGAAGGAGGCAGG - Intergenic
1146923362 17:36728275-36728297 TGGGGAAGGGGGGAGGGGGCAGG - Intergenic
1146927213 17:36753351-36753373 GAGCGAAGGGGTGTGGAGGGAGG + Intergenic
1147316198 17:39621614-39621636 CAGGGCAGGTGGGTGGGGGCAGG - Intergenic
1147388532 17:40095700-40095722 CAGCGATGTGGGGTGGTGGCTGG + Exonic
1147582783 17:41636491-41636513 TAGCAAAGGGGCCTGGGGGGGGG - Intergenic
1147588570 17:41666890-41666912 TTGCGGAGGGGGGAGGGGGTGGG - Intergenic
1147874868 17:43613969-43613991 TGGAGAAGGGAGGTGGGGGAGGG + Intergenic
1147876850 17:43627868-43627890 GAGAGATGGGGGGAGGGGGCAGG - Intergenic
1147966332 17:44196223-44196245 TGGGGAAGGGGGGTGGGGGAGGG - Intronic
1148212746 17:45818140-45818162 TGGCGCTGGGGAGTGGGGGCAGG - Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148460963 17:47838766-47838788 TAGTGAACGGTGGAGGGGGCTGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148557068 17:48585088-48585110 TGGCGAAGGGGGGAGGGGTAAGG - Intronic
1148842041 17:50505169-50505191 TAGGGGATGGGGGTCGGGGCTGG + Intergenic
1149286370 17:55169355-55169377 TATTGAATGGGGGTGGGGGTGGG + Intergenic
1149447508 17:56725034-56725056 TAGAGAAAGTGGGAGGGGGCAGG - Intergenic
1149984946 17:61340250-61340272 TGGCAAGAGGGGGTGGGGGCTGG + Intronic
1150133218 17:62680342-62680364 GAGCGAAGGGTGGCGGGGCCAGG + Intronic
1150194862 17:63287076-63287098 TAGCCAAGTGTGGTGGCGGCTGG - Intronic
1150497907 17:65623227-65623249 TGGTGAAGGTGGGTGGGGCCTGG + Intronic
1151315550 17:73319900-73319922 GAGCAAAGGGTGATGGGGGCAGG - Intergenic
1151369940 17:73641574-73641596 TGGGGATGGGGGGTGGGTGCTGG - Intronic
1151640964 17:75393842-75393864 GAGCCAGGGGGCGTGGGGGCTGG - Intronic
1151820348 17:76493592-76493614 TAGCAGAGGGGAGAGGGGGCTGG + Intronic
1151953697 17:77369993-77370015 AAGGGAAGGGGGATGGGGACAGG - Intronic
1151955442 17:77377907-77377929 GAGCCATGGGGAGTGGGGGCAGG + Intronic
1151979076 17:77498402-77498424 TGGGGAGTGGGGGTGGGGGCAGG + Intronic
1151979963 17:77502894-77502916 TGGCGTAGGGGGCAGGGGGCTGG - Intergenic
1152028487 17:77826917-77826939 AAGCGGCGGGGGGTGGGGGTGGG - Intergenic
1152040123 17:77897664-77897686 AAGGGAAGGGGGGTGGTGGGGGG - Intergenic
1152157790 17:78646236-78646258 TAGCGAAGGGTGGTGGGACCTGG + Intergenic
1152349732 17:79778017-79778039 CAGCGAGGGGGGGCGGGTGCGGG - Intergenic
1152356648 17:79810798-79810820 TGGCGGAGGGGGGTGGGGGGGGG - Intergenic
1152363079 17:79841289-79841311 TAGTTGCGGGGGGTGGGGGCCGG + Intergenic
1152427349 17:80225473-80225495 GAGCCAATGGGGGTGGGGCCAGG + Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153001439 18:459017-459039 TAGAGATGGGGACTGGGGGCTGG + Intronic
1153299661 18:3581592-3581614 TAGCCAAGAGGAGTAGGGGCTGG - Intronic
1154508579 18:15068873-15068895 AAGAGAGTGGGGGTGGGGGCGGG + Intergenic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1157460125 18:47884024-47884046 TAGGGAATGGGGCTGTGGGCTGG - Intronic
1158477129 18:57790297-57790319 TGGGGGATGGGGGTGGGGGCAGG - Intronic
1158572742 18:58610764-58610786 TAGGGACGGGGGGAGGGGGGTGG - Intronic
1158602653 18:58867904-58867926 GAGTCAAGGTGGGTGGGGGCAGG - Intronic
1158648190 18:59265628-59265650 TAGCGAAGGCGGGGAGGGGAAGG - Intergenic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1161151417 19:2712048-2712070 TAGGGGTGAGGGGTGGGGGCTGG + Intergenic
1161153034 19:2719579-2719601 CAGCGGTGGGGGGTGGGGGAGGG + Intronic
1161204457 19:3033831-3033853 TAGAGATGGGGGGTGGGGGTTGG - Intronic
1161283156 19:3456497-3456519 TAGCGAGGGGTTGTGGGAGCCGG - Intronic
1161397591 19:4052675-4052697 TAGCGGTGGGGGCAGGGGGCTGG - Intronic
1161416983 19:4152885-4152907 TTTCGGAGGGGGCTGGGGGCCGG + Intergenic
1161428703 19:4218185-4218207 TGGCCAATGGGGGTGGGGCCCGG - Intronic
1161646638 19:5456957-5456979 GAGCGAGGGGTGGTGAGGGCTGG + Intergenic
1161673389 19:5627181-5627203 AAAAAAAGGGGGGTGGGGGCGGG + Intronic
1161739074 19:6009329-6009351 GAGGGCAGGGGGGTGGGGGGCGG - Intronic
1161842723 19:6692786-6692808 TTGGGCTGGGGGGTGGGGGCAGG - Intronic
1161849594 19:6731572-6731594 GAGGGGAGGGGGCTGGGGGCTGG + Intronic
1161920867 19:7264814-7264836 TAGTGAAGGGTGGTGGGAGAGGG - Intronic
1162315663 19:9936607-9936629 TCGGGTGGGGGGGTGGGGGCGGG + Intergenic
1162405285 19:10469432-10469454 TGGAGAAGGGGGGAGGGGACAGG - Exonic
1162660809 19:12167714-12167736 TAGAGACGGGGTGTGGTGGCAGG - Intronic
1162900952 19:13795383-13795405 TAGGGACAGGCGGTGGGGGCGGG + Intergenic
1162949514 19:14062148-14062170 CAGAGAGGGGGGCTGGGGGCTGG + Intergenic
1163547945 19:17950488-17950510 AAGAGAAGGGAGGTGGGGGGAGG + Intergenic
1163677752 19:18663750-18663772 TAGCAAAGGGGTGGTGGGGCTGG + Intronic
1163723603 19:18910177-18910199 CAGCCAAGGGGAGAGGGGGCTGG - Intronic
1163859970 19:19737752-19737774 TAGTGAAGGTGCGTGGGGGGAGG - Intergenic
1164868727 19:31625943-31625965 TAGAGAAGTGGAGTGGAGGCAGG - Intergenic
1164907420 19:31978649-31978671 TATAGGAGGGGGCTGGGGGCTGG - Intergenic
1165104411 19:33460583-33460605 TAGAGCAGGGGGGTGGGTACGGG - Intronic
1165154272 19:33777737-33777759 TAGGGAAGGGGGCAGGGGGCAGG + Intergenic
1165324632 19:35107387-35107409 CAGAGATGGGGGGTAGGGGCAGG - Intergenic
1165470312 19:35999623-35999645 TGGCGAGCGGGGTTGGGGGCGGG - Intergenic
1165470941 19:36004193-36004215 TAGAGATGGGGGGAGGGGGCAGG + Intronic
1166035207 19:40163221-40163243 GAGGGAAGGGGGGAGGGGGAGGG + Intergenic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166305563 19:41935220-41935242 TAGAGAAGTGGGCTGGGGTCAGG + Intergenic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
1166885880 19:45960813-45960835 GAGCAGATGGGGGTGGGGGCAGG - Intronic
1167149691 19:47701725-47701747 TAGCGGGGGGTGGCGGGGGCTGG - Exonic
1167277104 19:48545327-48545349 TGGGGAAGGGGGTTGGGGGGAGG - Intergenic
1167514461 19:49915034-49915056 TAAGGAAAGGGGTTGGGGGCCGG - Intronic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167792620 19:51690901-51690923 TGGTGTGGGGGGGTGGGGGCGGG + Intergenic
1168153455 19:54460934-54460956 CAGCGAGGAGGGGCGGGGGCAGG + Exonic
1168211558 19:54894398-54894420 CAGCGAAGGGGGATAGGGGTGGG + Intergenic
1168227514 19:55006928-55006950 CAGCGAAGGGGGATAGGGGTGGG + Intergenic
1168228303 19:55012115-55012137 CAGCGAAGGGGGATGGGGTGGGG + Intergenic
1168239351 19:55081502-55081524 TAAGGAAGGGGTCTGGGGGCAGG + Intronic
1168315490 19:55483166-55483188 TGGAGCAGGGGGCTGGGGGCCGG - Exonic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
925139455 2:1539868-1539890 TGGGGAATGGGGGCGGGGGCAGG + Intronic
926056933 2:9779208-9779230 AAGAGAAGGCGGGTGGTGGCCGG - Intergenic
926233915 2:11025130-11025152 AAGCCAGGGTGGGTGGGGGCTGG - Intergenic
926442432 2:12903898-12903920 TGGTGAAGGGGACTGGGGGCTGG - Intergenic
927259144 2:21069497-21069519 TGGGGTAGGGGGGTGGGGGGAGG - Intergenic
927612640 2:24557159-24557181 TAGCAACGGTGGGTTGGGGCGGG + Intronic
927687156 2:25179075-25179097 TACCTAACGGGGGCGGGGGCTGG - Intergenic
928602458 2:32916228-32916250 TAGGGGGGGGGGGTGGGGGGGGG + Intergenic
928859995 2:35846129-35846151 TAGCGGTGGGGGGCGGGGGGGGG + Intergenic
929562834 2:42966425-42966447 TGGCGGGGGGGGGTGGGGGGGGG + Intergenic
931348840 2:61470847-61470869 AAGAGAATGGGGGAGGGGGCCGG + Intergenic
931622722 2:64227391-64227413 TATGGAAGTGGGGTGGGGGAGGG + Intergenic
932231862 2:70089586-70089608 TGGGGAAGGGGTGTGGGGGCAGG + Intergenic
932431680 2:71679356-71679378 GAGAGAGGGGGGATGGGGGCAGG - Intronic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
932495232 2:72142856-72142878 AAGGGAACGGGGGTGGGGGCAGG + Intronic
932751319 2:74373491-74373513 TGGGGAAGGGGGTTGGGGGAGGG - Intronic
934033078 2:88065269-88065291 GAGGGAAGGGGGGGGGGGGAGGG - Intergenic
935706505 2:105861935-105861957 AAGGGAAGGGGGGAGCGGGCAGG - Intronic
936233928 2:110726719-110726741 TGGAGATGGGGGGTGGGGGGTGG + Intergenic
936346383 2:111678627-111678649 CAGGGAAGGGGGGCGGGGGGAGG - Intergenic
937150938 2:119685209-119685231 CTGCAAAGGGGGGGGGGGGCGGG - Intronic
937403345 2:121605119-121605141 TAGGGAGTGGGGGTGGGGGTGGG - Intronic
937913110 2:127085765-127085787 TAGGGAAGGGGGCTGAGGCCTGG - Intronic
938265203 2:129923360-129923382 CAGCGACCGGGTGTGGGGGCGGG + Intergenic
939043123 2:137216272-137216294 TAATGCAGGGGGGTGGGGGGCGG - Intronic
939652351 2:144779549-144779571 GAGAGATGAGGGGTGGGGGCAGG - Intergenic
939968564 2:148635386-148635408 TAGAGACGGGGGTTGGGGGGGGG - Intergenic
940241472 2:151567849-151567871 AAGCCAAGGGGGGTGGTGGGCGG + Intronic
940398961 2:153224321-153224343 TAGAGAAGGGGGGAAGGGGGTGG + Intergenic
940739496 2:157490876-157490898 TATTGAAGCTGGGTGGGGGCAGG - Intergenic
941858438 2:170253882-170253904 TGGGGACGGGGGGCGGGGGCGGG + Intronic
942043541 2:172086098-172086120 GAGCGAGGTGGGGTGGGGGTGGG + Intronic
942241068 2:173964563-173964585 CAGCGCGGGGGGGTGGGGGTGGG + Intronic
942292547 2:174486958-174486980 CGGCGAAGAGGGCTGGGGGCGGG - Exonic
943181152 2:184542872-184542894 TGGGGTAGGGGGGTGGGGGAGGG + Intergenic
944218749 2:197281335-197281357 TGGTGATGGGGGGTGGGGGATGG - Intronic
944465205 2:199993725-199993747 TAGAGAAGGGGACTGGGGGTGGG + Intronic
944507224 2:200425125-200425147 TGGCGGGGGGGGGGGGGGGCGGG - Intronic
945039829 2:205734400-205734422 TTGCGATGCGGGGTGGGGGGGGG - Intronic
945688012 2:212996241-212996263 CAGCGAAGGGAGGTGGGGTGGGG + Intergenic
945844368 2:214926746-214926768 CAGTGGAGGGGGGCGGGGGCAGG + Intergenic
945983994 2:216339989-216340011 GAGGGAAAGGGGGTGGGTGCTGG - Intronic
946330477 2:219006116-219006138 TGGCGAGGGTGGCTGGGGGCAGG + Exonic
946857728 2:223969552-223969574 TAGCGGGGGGGGGGGGGGGGCGG - Intergenic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
947395592 2:229683821-229683843 TAGGGATGGGGGCTGGGGGCTGG + Intronic
947575394 2:231269862-231269884 TAGGGGGGGAGGGTGGGGGCGGG - Intronic
948194702 2:236086851-236086873 TAGGGCAGGGGGGTGGGGGAGGG - Intronic
948616337 2:239201649-239201671 TTGAGAAGGGAGGTGGGGCCTGG - Intronic
948751944 2:240138031-240138053 TAGAGAAGGGGAGTGGGGGGCGG + Intergenic
948767457 2:240230631-240230653 AAGGGAAGGGGCCTGGGGGCAGG + Intergenic
949086463 2:242160101-242160123 CAGGGATGCGGGGTGGGGGCAGG - Intergenic
1168771828 20:420720-420742 TAGGGATGGGGGATGGGGGACGG - Intronic
1168793492 20:595918-595940 CAGGGAAGGTGGGTGGGGGTGGG + Intergenic
1169105310 20:2989484-2989506 TAGGCAAGGGTGGTGGGGACAGG + Intronic
1169437371 20:5604606-5604628 TAGTGCGGGGGGGGGGGGGCGGG + Intronic
1171499965 20:25585620-25585642 GAGCGAACGGGAGAGGGGGCGGG + Intergenic
1172028869 20:31968001-31968023 CAGCTCAGGCGGGTGGGGGCGGG + Exonic
1172301314 20:33852468-33852490 GAGAGATGGAGGGTGGGGGCGGG + Intronic
1172507333 20:35473276-35473298 TGGAGAAGGGGGTCGGGGGCTGG - Intronic
1172841727 20:37906046-37906068 TGGGGGTGGGGGGTGGGGGCTGG + Intronic
1172891237 20:38266988-38267010 TAGTGGTGGGGGGTGGGGGTGGG + Intronic
1172941639 20:38658490-38658512 TAGGGTTGGGGGGTGGTGGCTGG + Intergenic
1173248930 20:41354406-41354428 TAGGGACCGGGGCTGGGGGCAGG + Intronic
1173291961 20:41723173-41723195 TAGGGAAGAGGGGTGAGGGGAGG - Intergenic
1173588796 20:44208115-44208137 TGCCCAAGAGGGGTGGGGGCGGG - Intronic
1173627270 20:44482386-44482408 TAGAGACAGGGGGTGGGGGTTGG - Intronic
1173879541 20:46401451-46401473 GTGAGAAGGGGTGTGGGGGCAGG + Intronic
1174049617 20:47758603-47758625 CAGCGAAGGTGGGTGCGGGGAGG + Intronic
1174775752 20:53341707-53341729 TGGGGCAGGGGGGTGCGGGCTGG + Intronic
1175344586 20:58263624-58263646 TAGGGTATGGGGGTGGGGGTAGG - Intergenic
1175825859 20:61936339-61936361 TGGGGAAGGGGTGTGGGGGAAGG - Intronic
1176105547 20:63384171-63384193 TAGGGATGGGTGGTGGGGGGTGG - Intergenic
1176217609 20:63955722-63955744 TGACGAACCGGGGTGGGGGCGGG + Intronic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1176789501 21:13302856-13302878 AAGAGAGTGGGGGTGGGGGCGGG - Intergenic
1176857030 21:13981518-13981540 CAGCGGGGGGGGGGGGGGGCAGG - Intergenic
1178636521 21:34308528-34308550 TAATGAGGGTGGGTGGGGGCAGG + Intergenic
1178879891 21:36441054-36441076 CATGGCAGGGGGGTGGGGGCGGG - Intergenic
1179048718 21:37870216-37870238 TGGGGCCGGGGGGTGGGGGCGGG - Intronic
1179366804 21:40766133-40766155 TAGCAAAAGGGGTTGGGGGTGGG + Intronic
1179479547 21:41668770-41668792 AAGCCAGTGGGGGTGGGGGCTGG - Intergenic
1179572328 21:42285008-42285030 CAGCGAAGGGGGCTGGGGAGTGG + Intronic
1179595970 21:42443528-42443550 TGGAGAATGGGGGCGGGGGCAGG - Intronic
1179669641 21:42937620-42937642 TAGTGATTTGGGGTGGGGGCAGG - Intergenic
1179707259 21:43188834-43188856 TTAAGAAGGGTGGTGGGGGCGGG - Intergenic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1181311677 22:21948303-21948325 TAGAGATGGGGGGTGGGGGGGGG - Intronic
1181527665 22:23499391-23499413 TGCCGATGGGGGGTGGGGGTGGG - Intergenic
1181528255 22:23502232-23502254 TAGGGATGGGGGATGGGGGATGG - Intergenic
1181533011 22:23527747-23527769 AAGCCAAGGAGGGTGAGGGCAGG + Intergenic
1181639735 22:24190230-24190252 TAGCGGAGGGGAATGGGGTCTGG + Intergenic
1181899916 22:26145258-26145280 GAGCAAAGGGGGGTGGAGGAGGG - Intergenic
1182093202 22:27609703-27609725 CAGGGAGTGGGGGTGGGGGCGGG + Intergenic
1182181577 22:28354972-28354994 TAGTAAAGTGGGGTGGGGGGAGG - Intronic
1182318668 22:29464251-29464273 TAGCCAAGGGGAGGGGGGGAGGG + Intergenic
1182352458 22:29706552-29706574 CAGCAAATGGGTGTGGGGGCTGG + Intergenic
1183024249 22:35052296-35052318 AAGGGATGGGGGGTGGGGGTGGG - Intergenic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183364921 22:37401863-37401885 TCGCCAAGGAGGCTGGGGGCGGG - Intronic
1183413117 22:37666839-37666861 CAGTGATGGTGGGTGGGGGCTGG + Exonic
1183586881 22:38757941-38757963 TAGAGATGGGTGGTGGGGGGGGG - Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183956300 22:41382307-41382329 CAGCGGAGGGGGATGGGGCCTGG + Intronic
1184034940 22:41913868-41913890 GAGGGCAGGGGGGTGGGGGCGGG - Intronic
1184043682 22:41958863-41958885 CAGCGAAGGGGGGCGGGGTGAGG - Intergenic
1184050055 22:41997765-41997787 TGGGGAAGGGGGTTGGGGGTAGG - Exonic
1184089110 22:42283313-42283335 GAGCGGCGGGGGGTTGGGGCTGG - Intronic
1184137813 22:42559554-42559576 TAGCCAAGCGTGGTGGTGGCGGG + Intronic
1184561916 22:45268561-45268583 GAGGTGAGGGGGGTGGGGGCGGG - Intergenic
1184571228 22:45326170-45326192 CAGAGAGGCGGGGTGGGGGCGGG - Intronic
1185196001 22:49469917-49469939 TGGCGAAGAGGGAGGGGGGCAGG + Intronic
1185223159 22:49639324-49639346 TAGAGAGGGGGCGTGAGGGCAGG - Intronic
1185272478 22:49935573-49935595 TGGGGACGGAGGGTGGGGGCGGG + Intergenic
1185309569 22:50146461-50146483 CAGTGCAGGGGGGTGGGGTCGGG + Intronic
1185343617 22:50302108-50302130 TGGGGAAGTGGGGTGGGGGCAGG + Intronic
950156277 3:10723772-10723794 TTGGGAAGGAGGGTGGGGGAGGG + Intergenic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950183531 3:10931383-10931405 GAGCAACGGGAGGTGGGGGCGGG + Intronic
952110716 3:30121180-30121202 TAGCCAAGCGTGGTGGTGGCGGG + Intergenic
952492115 3:33882749-33882771 AAGCGTGGGGTGGTGGGGGCAGG - Intergenic
952494382 3:33902990-33903012 TAGGGAAGAGGGGTGTAGGCAGG + Intergenic
953030642 3:39177720-39177742 GGGCGGAGGGGGGAGGGGGCGGG + Intergenic
953106399 3:39884922-39884944 GGGAGAAGGGGGGTGGGGGGAGG - Intronic
953510603 3:43534520-43534542 GAGAGAAGGGGGTTGGGGGGAGG + Intronic
953709857 3:45260797-45260819 AAGCCATGAGGGGTGGGGGCGGG - Intergenic
953927194 3:46988502-46988524 TGGAGAAGGGGAGTGGGGGACGG - Intronic
953941969 3:47107717-47107739 TGGCGGGGGGGGGTGGGGGGGGG + Intronic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954063313 3:48087532-48087554 TAGAGATGGGGGGCGGGGGCAGG - Intronic
954073157 3:48157996-48158018 CAGGGAAGGGGGGTGGGGGTAGG - Exonic
954274433 3:49533100-49533122 CTGTGAAGGGCGGTGGGGGCTGG - Exonic
954436965 3:50501384-50501406 TAGAGAATGAGGGTGGGGGTGGG - Intronic
954446081 3:50547586-50547608 TAGCCTTGGGGGCTGGGGGCTGG + Intergenic
955579804 3:60406662-60406684 TAGAGAAGGATGGTGGGGGGTGG + Intronic
955672993 3:61421448-61421470 CAGGGAATGGGGGTGGGGGGGGG - Intergenic
956026883 3:64992666-64992688 TAGGGCAGTGGGGTGGGGGAAGG + Intergenic
956051847 3:65256664-65256686 TGGGGAAGGGGGGTGGGGTGGGG - Intergenic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
956827154 3:73008030-73008052 ATGGGAGGGGGGGTGGGGGCTGG - Intronic
959426526 3:106196672-106196694 TAGTGAAGGGGAGTTGGGGAGGG - Intergenic
960309648 3:116105460-116105482 CAGCGAAGGGAGGTAGGGGTGGG + Intronic
960310494 3:116110900-116110922 CAGCGAAGGGAGGTAGGGGTGGG + Intronic
960432034 3:117581083-117581105 GAGCAAATGGGGGTGGGGGAAGG - Intergenic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961637354 3:128341905-128341927 AAGGGAAGGGGTGTGGGGCCAGG - Intronic
962288934 3:134114023-134114045 CAGTGAATGGGGGTGGGGGTGGG - Intronic
962294431 3:134168620-134168642 TAGGGTAGGGGGATGGGGGAGGG + Intronic
962481644 3:135803215-135803237 TAGCGGAGGGGGAAGGGGACAGG - Intergenic
962503952 3:136027172-136027194 CAGTGAAGGGGGGTGGGATCCGG - Intronic
962652493 3:137510552-137510574 TGGGGATTGGGGGTGGGGGCGGG - Intergenic
963320645 3:143805803-143805825 TAGCGAAGGGAGATAGGGGTGGG - Intronic
964450613 3:156809409-156809431 TGGGGAACTGGGGTGGGGGCAGG + Intergenic
965070878 3:163913865-163913887 CAGCGAAGGGAGGTAGGGGTGGG - Intergenic
965646505 3:170887554-170887576 TAATGATGGGGGGTGGGGGAAGG + Intergenic
965693298 3:171380662-171380684 TTGTGAAGAGGGGTGGGGACAGG - Intronic
966882954 3:184360241-184360263 TGGTGAAGGGGGGCGGGAGCAGG + Intronic
967525618 3:190489154-190489176 GAACGAAGGGGGGAGGGGGGAGG - Intergenic
968293635 3:197556788-197556810 TAGCGCAGTGGGGTGGGGTTGGG - Intronic
968967841 4:3778289-3778311 TGGCGAAGGTGGGTTGGGGTGGG + Intergenic
969221091 4:5759062-5759084 TTGTGGAGGGCGGTGGGGGCGGG + Intronic
969245995 4:5933415-5933437 TAGGGACGGGAGGTGGAGGCAGG - Intronic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
970323106 4:14894995-14895017 CAGAGAAAGGGGGTAGGGGCAGG - Intergenic
970852216 4:20615914-20615936 CAGGGAAGGGGGGAGGGTGCTGG - Intronic
971154142 4:24064240-24064262 TAACGAAGAGGGGAGGGGGCTGG + Intergenic
971553436 4:27981251-27981273 CAGCGAAGGGAGGTAGGGGTGGG - Intergenic
972204787 4:36758964-36758986 CAGCGGAGCGGGGTGGGGGGTGG - Intergenic
975364427 4:73512246-73512268 TAGTGAGGGTGGGAGGGGGCAGG - Intergenic
975473174 4:74793877-74793899 GAGGGTCGGGGGGTGGGGGCAGG - Intronic
975801213 4:78059880-78059902 TAGAGACGGGGGGCGGGGGCGGG + Intronic
977169878 4:93749056-93749078 TAGCAAAAGTGGGTGGGGGTGGG + Intronic
977586800 4:98783431-98783453 TTACAAAGGTGGGTGGGGGCAGG + Intergenic
977616219 4:99089618-99089640 TAGAGATTGGGAGTGGGGGCAGG + Intergenic
978101936 4:104852346-104852368 TAGGGAATGGTGGTGGGGGAGGG - Intergenic
979724346 4:123942550-123942572 CAGCAAATGGGGGTGGGGGCGGG - Intergenic
980774532 4:137421298-137421320 GAGCCCAGGGCGGTGGGGGCAGG - Intergenic
981240921 4:142474792-142474814 TAGCTAAGAGAGGTAGGGGCAGG - Intronic
981324915 4:143434761-143434783 GAGGAAAGGGGTGTGGGGGCAGG - Intronic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
982187641 4:152819005-152819027 GAGCAAAGCTGGGTGGGGGCTGG - Intronic
982380150 4:154741187-154741209 TGACGAAGGGGGGTCGGGGGCGG + Intronic
983077779 4:163345923-163345945 CAGGGAGGGGGGGTGGGGGAGGG - Intronic
984276635 4:177618959-177618981 TGGCGGTGGGGGTTGGGGGCAGG - Intergenic
984713498 4:182905063-182905085 CAGAGAAGTGGGGTGGTGGCTGG - Intronic
985629367 5:1006801-1006823 TGGAGGTGGGGGGTGGGGGCGGG - Intergenic
985762319 5:1755921-1755943 TTGCTCAGGGGGGCGGGGGCCGG - Intergenic
986321242 5:6633879-6633901 TAGGGTAGGGGGCCGGGGGCCGG - Intronic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
989139482 5:38189037-38189059 TAGCACAGGGGGGTCTGGGCTGG + Intergenic
989330330 5:40250779-40250801 GAGTGGTGGGGGGTGGGGGCAGG + Intergenic
991584189 5:68186121-68186143 GAGCGCACGGCGGTGGGGGCGGG - Intergenic
992444042 5:76818937-76818959 CAGGGAAGGGGGCCGGGGGCGGG + Intronic
993137551 5:83989311-83989333 TAGCTCATGGGGGTGGGGGCAGG - Intronic
994100105 5:95882577-95882599 TACCGAGGTGGGGTGGGGGTGGG + Intergenic
995065706 5:107859551-107859573 TAGCTTGGGGGGGTGGGGGTGGG - Exonic
995540778 5:113183903-113183925 TTGTGAAGATGGGTGGGGGCGGG - Intronic
997373819 5:133382938-133382960 GAGAGAAGGGGGGTGGGAGAAGG + Intronic
998130698 5:139649821-139649843 AAGCGAAGGGGAGGGGGGTCGGG - Intronic
998232095 5:140367310-140367332 TAGTGACTTGGGGTGGGGGCAGG + Intronic
998371495 5:141664876-141664898 GAGCCAATGGGGGTGGGGGGTGG - Intronic
998442449 5:142173837-142173859 TGGAGAATGGGGGTGGGGGGAGG + Intergenic
999101457 5:149029009-149029031 TACTGTAGGGGGGTGGGGGGTGG + Intronic
999531813 5:152471598-152471620 GAGCCAAGTGGGGTGGGAGCGGG + Intergenic
1000285111 5:159819968-159819990 TAGGGATGGGGGGTGGGGAGTGG + Intergenic
1001905549 5:175469793-175469815 TAGCAAAGGGAGTTGGGGGTTGG + Intergenic
1002072479 5:176688383-176688405 TGGGGGTGGGGGGTGGGGGCAGG + Intergenic
1002189895 5:177472918-177472940 GAGCGGAGCGGGCTGGGGGCCGG - Exonic
1002212058 5:177605019-177605041 GAGGGAAAGGAGGTGGGGGCTGG - Intronic
1002472182 5:179442106-179442128 TAGCAAAGGAGGGTGTAGGCCGG - Intergenic
1002487867 5:179551667-179551689 TATGGGAGGGGGGTGGGGGCGGG - Intronic
1003275571 6:4647778-4647800 GAGCGAGAGGGGGTGGGGACAGG - Intergenic
1004044749 6:12012616-12012638 GGGCGGAGGGGGGGGGGGGCAGG + Intronic
1004149003 6:13097339-13097361 AGGTGAAGAGGGGTGGGGGCAGG - Intronic
1004379364 6:15119010-15119032 AAGAGAAGTGGGGTGGGGGGAGG - Intergenic
1004492092 6:16127197-16127219 TCGTGAAGGGGGGTAGGGACAGG + Intergenic
1004702282 6:18090570-18090592 TGGGGGAGAGGGGTGGGGGCAGG - Intergenic
1005140465 6:22626181-22626203 CAGGAAAGGAGGGTGGGGGCTGG - Intergenic
1005347918 6:24908741-24908763 AAGCCAAGGAGGCTGGGGGCGGG - Intronic
1005380038 6:25224537-25224559 TAGCATTCGGGGGTGGGGGCGGG - Intergenic
1005587831 6:27294215-27294237 TAATGAAAGGGGGGGGGGGCGGG + Intronic
1005897624 6:30191547-30191569 GAGTGAAGGGGGATGGGAGCAGG + Intronic
1006180714 6:32151945-32151967 CAGCGGCGGGGGGGGGGGGCGGG + Exonic
1006377308 6:33678579-33678601 GGGGGATGGGGGGTGGGGGCGGG + Intronic
1006863897 6:37192859-37192881 TCGGGAAGCGGGGAGGGGGCAGG + Intergenic
1007656949 6:43456119-43456141 GAGGGAAGGGTGGTGGGGGTAGG - Exonic
1008449663 6:51635849-51635871 TGGTGAAGGTGGGGGGGGGCGGG + Intronic
1009750474 6:67873501-67873523 GAGAGAAGGGGTGTGGGGGGGGG + Intergenic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1011643221 6:89433699-89433721 GAAGGAAGGGCGGTGGGGGCGGG + Intronic
1012150449 6:95743761-95743783 TAGCAATGGGGGGTGGGGAGGGG + Intergenic
1012945571 6:105461970-105461992 TTAAGAAGGTGGGTGGGGGCAGG - Intergenic
1013168571 6:107616071-107616093 TGAGGAAGGGGGGTGGGGGGGGG + Intronic
1013441822 6:110179278-110179300 CCGCGGATGGGGGTGGGGGCCGG + Intronic
1014569968 6:122996602-122996624 CAGAGAAGAGGGGTGGCGGCGGG - Exonic
1016356120 6:143220083-143220105 TAGCTTAGGGGGCAGGGGGCAGG + Intronic
1017450699 6:154552082-154552104 TGGTGGAGTGGGGTGGGGGCGGG - Intergenic
1018136115 6:160779833-160779855 TAGGGAAGCGGGGTGGGGGGGGG - Intergenic
1019019295 6:168904095-168904117 ACGAGAAGTGGGGTGGGGGCAGG + Intergenic
1019126091 6:169840948-169840970 CAGCAAAGAGGGGTGGGGGTGGG - Intergenic
1019187778 6:170230949-170230971 TAGGGAAGGAGGGTGGAGTCTGG + Intergenic
1019463091 7:1171848-1171870 TAGAGGTGGGGGGGGGGGGCGGG - Intergenic
1019578150 7:1747360-1747382 TAGGGATGGGGGGTGGGGGTGGG + Exonic
1019870297 7:3754675-3754697 AGGGGAAGGGGGGTGGGGGGCGG + Intronic
1020186151 7:5960897-5960919 AAGTGTTGGGGGGTGGGGGCGGG + Intronic
1020296764 7:6763873-6763895 AAGCGTTGGGGGGTGGGGGCGGG - Intronic
1020535392 7:9389827-9389849 TAGAGATGGGGGGTGGGGATGGG + Intergenic
1021126457 7:16855580-16855602 AAGAGAAGGGGGCTGGGGACAGG + Intergenic
1021913345 7:25408006-25408028 AAGTGATGGGGAGTGGGGGCAGG - Intergenic
1022299684 7:29091396-29091418 GAGGGATGGGAGGTGGGGGCGGG + Intronic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1022508774 7:30922356-30922378 CAGCGCTGGGGGCTGGGGGCAGG + Intronic
1024037833 7:45523795-45523817 TAGCTCAGGGGGGTAGTGGCAGG + Intergenic
1024095223 7:45977433-45977455 TAGTGCAGGGTGGTGGGTGCCGG + Intergenic
1024608954 7:51046517-51046539 AAGAGATGTGGGGTGGGGGCAGG - Intronic
1024743964 7:52386054-52386076 GAGGGAAGGGGGATGGGGGTGGG + Intergenic
1025872633 7:65449193-65449215 AAGGGAAGGGGGGAGGGGGGAGG - Intergenic
1025975175 7:66363944-66363966 TAACTAAGGGGGTTGGGGGGGGG + Intronic
1026141622 7:67711825-67711847 TAGGGAAGGTGAGTGGGAGCCGG + Intergenic
1026455937 7:70572450-70572472 CAGGGATGGGGGGTGGGGGTGGG + Intronic
1026479396 7:70765035-70765057 CAGCGAGGGGCGGTGGGGGTCGG - Intronic
1026537383 7:71251159-71251181 TAGCAAAAGGGGGAGGGGGGAGG - Intronic
1026923791 7:74174749-74174771 TACCGTAGGGGGGATGGGGCTGG - Intronic
1027361663 7:77416176-77416198 CTGCGGAGAGGGGTGGGGGCGGG - Intronic
1028162284 7:87499140-87499162 TAGCGATGGGAGGAGGGGGAGGG - Intergenic
1029264654 7:99328651-99328673 TAAAGAAAAGGGGTGGGGGCCGG + Intronic
1029537107 7:101163330-101163352 GAGCGGACGTGGGTGGGGGCGGG + Exonic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1030227680 7:107169837-107169859 TGGCGAAAGAGGGTGGGGGATGG + Intronic
1031483840 7:122306191-122306213 AAGCAAAGGGCGGTGGGGCCTGG + Intronic
1032027617 7:128456046-128456068 TAGCGATGGGGGTGGGGAGCCGG - Intronic
1032096114 7:128939203-128939225 TAACTACTGGGGGTGGGGGCAGG - Intronic
1032181031 7:129677988-129678010 GGGGGAAGGGGGGAGGGGGCGGG + Intronic
1032204594 7:129850849-129850871 GAGGGAAGGGGGATGGGGGGAGG + Intronic
1033056234 7:138057500-138057522 TTGGGGTGGGGGGTGGGGGCAGG + Intronic
1033167382 7:139052271-139052293 GAGGGGAGGGGGGTGGGGGGAGG - Intronic
1034051412 7:147988083-147988105 AAGCGGAGGGTGGTGGGGGTAGG + Intronic
1034210122 7:149356145-149356167 TGGCGGTGGGGGGTGGGGGGCGG - Intergenic
1034707509 7:153158670-153158692 CAGAGATGGGGGTTGGGGGCTGG + Intergenic
1035062879 7:156082199-156082221 TAGCCCAGTGGGGTGGGAGCTGG - Intergenic
1035086259 7:156261092-156261114 TAGAGGCTGGGGGTGGGGGCGGG + Intergenic
1035414437 7:158671079-158671101 TGGGGCAGGGGGGTGGGGGTGGG + Intronic
1035414460 7:158671161-158671183 TGGGGCAGGGGGGTGGGGGTGGG + Intronic
1035736959 8:1895897-1895919 TAGAAATGGGGGCTGGGGGCGGG - Intronic
1035956367 8:4084736-4084758 TTGGGTAGGGGGGTGGGGGTGGG - Intronic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1036640005 8:10577206-10577228 CAGCGAAGGGAGGTAGGGGTGGG - Intergenic
1036675535 8:10828876-10828898 TAGCGTAGGGGTGTGAGGGCCGG - Intronic
1036811128 8:11868194-11868216 TGGCGGGAGGGGGTGGGGGCTGG - Exonic
1037825022 8:22155783-22155805 TGGGGCATGGGGGTGGGGGCTGG + Intronic
1038038579 8:23705952-23705974 TAGGGAAGGGCGGTGGTGACTGG + Intronic
1038392781 8:27220098-27220120 TAGAGAAGTGGGGTGGGTGAAGG - Intergenic
1039311417 8:36321649-36321671 TAGCCAGGGGTGGTGGCGGCGGG + Intergenic
1039622341 8:39009889-39009911 TAGTGATGGGGGGGGGGGGCAGG + Intronic
1040920821 8:52614608-52614630 TAGAGAAGGGTGCTGGGGGAAGG + Intergenic
1041018535 8:53615554-53615576 TGGCGTTGGGGGGTGGGGGATGG - Intergenic
1041227737 8:55716993-55717015 TATTGATGGGGGGTGGGGGTGGG + Intronic
1041270894 8:56107639-56107661 TAGCGAAGGGAGATAGGGGTGGG - Intergenic
1041555005 8:59143633-59143655 CTGCGAATGGTGGTGGGGGCAGG + Intergenic
1041781815 8:61585344-61585366 TGGAGAAGGGGAGTGGTGGCAGG + Intronic
1041866738 8:62582595-62582617 GAGTGAAGGGGGGTCTGGGCCGG + Intronic
1042007808 8:64201788-64201810 TAGGTAAGGGGGCTGGAGGCTGG + Intergenic
1042151469 8:65790339-65790361 TAGGGAGGTGGGGTAGGGGCTGG + Intronic
1042217024 8:66437536-66437558 TGGGGGAGGGGGGTGGGGGCAGG - Intronic
1042911888 8:73836256-73836278 TAGCTAAGAAGGCTGGGGGCTGG - Intronic
1043282834 8:78489698-78489720 TAGCTAGGGGTGGTGGGGGTGGG - Intergenic
1044582884 8:93839833-93839855 CTGGGAAGGGGAGTGGGGGCTGG - Intergenic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1045296006 8:100872158-100872180 TGGAGAAGGGGGCTGGGGGTGGG - Intergenic
1045662541 8:104453028-104453050 TGGGGGAGGGTGGTGGGGGCCGG - Intronic
1046121398 8:109851810-109851832 CAGCTATGGGGGGCGGGGGCGGG + Intergenic
1046609008 8:116403603-116403625 TACATAAGGGGGCTGGGGGCTGG - Intergenic
1047019433 8:120759065-120759087 TAGCTAAAGTGGGTTGGGGCTGG - Intronic
1048480406 8:134785491-134785513 TGGCGGAGGGGGGAGGGGGCGGG - Intergenic
1048711357 8:137214968-137214990 GAGAGAATGGAGGTGGGGGCGGG + Intergenic
1048831255 8:138479398-138479420 TAGACGAGGGGAGTGGGGGCTGG - Intronic
1049194063 8:141306012-141306034 TATTGGAGGGGGGTGGGGGAGGG - Intronic
1049306253 8:141905865-141905887 TGGCCAAGGGGCGTGGGGGCGGG + Intergenic
1049537581 8:143189511-143189533 GAGCCCACGGGGGTGGGGGCGGG - Intergenic
1049584999 8:143428956-143428978 GAACGAAGGAGGGCGGGGGCAGG + Exonic
1049610489 8:143552805-143552827 TAGGGAGGTGGGGTGGGGGGTGG + Intergenic
1051868836 9:21713754-21713776 AAGCAAAGGGGGGAGGGGGGAGG + Intergenic
1053141830 9:35687453-35687475 TAGGGAAAGGAGGTGGGGGGAGG + Intronic
1054323939 9:63703886-63703908 GAGTAAGGGGGGGTGGGGGCGGG - Intergenic
1057888616 9:98851068-98851090 TAAAGAAGGGGGCGGGGGGCGGG - Intergenic
1058010508 9:99971729-99971751 TTGAGATGGGGGTTGGGGGCAGG + Intergenic
1058493663 9:105530286-105530308 TAGGGAAGTGGGGTGAGGGAGGG + Intronic
1059047380 9:110883949-110883971 TAGAAAATGGGGGTGGGGGAGGG - Intronic
1059206941 9:112476257-112476279 AAGCGGGGGGGGGGGGGGGCGGG - Intronic
1059573943 9:115469984-115470006 TAGGGATGGGGTCTGGGGGCAGG + Intergenic
1060506685 9:124202987-124203009 GTGGGGAGGGGGGTGGGGGCGGG + Intergenic
1060618919 9:125044984-125045006 TAGCGAATGGGCATGGGGTCTGG - Intronic
1060896816 9:127224120-127224142 TAGCGAAGTGGGGATGGGGTTGG + Intergenic
1061248910 9:129415195-129415217 TGGAAAAGGGGGGTGGGGGAAGG - Intergenic
1061255710 9:129453504-129453526 TAGGGATGGAGGGTGGGGGATGG + Intergenic
1061306440 9:129735785-129735807 TATGGAAGGGAGGTGGGGGTGGG - Intergenic
1061369713 9:130191511-130191533 TAAGGAAGGGAAGTGGGGGCCGG + Intronic
1062160705 9:135078027-135078049 TCGGGAATGGGTGTGGGGGCAGG + Intronic
1062315386 9:135964650-135964672 GGGTGAAGCGGGGTGGGGGCTGG - Intergenic
1062395229 9:136350129-136350151 CAACAAAGGAGGGTGGGGGCTGG - Intronic
1062402137 9:136377454-136377476 TGGAGCAGTGGGGTGGGGGCTGG - Intronic
1062444622 9:136588432-136588454 TGGTGAATGGGGGTGGGGGGGGG - Intergenic
1062698662 9:137888105-137888127 TAGGGAAGGAGAGTGGGAGCCGG + Intronic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1185943568 X:4348767-4348789 AAGAGAAGGGAGGTGGGGACAGG - Intergenic
1186351780 X:8747527-8747549 TAGCGGTGGGGGGAGGGGGGAGG - Intergenic
1186420401 X:9420936-9420958 TACGGCAGGGGGCTGGGGGCCGG - Intergenic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187163902 X:16787130-16787152 GAGCGCAGGGGGGCGGGGGAAGG - Intronic
1187571940 X:20513344-20513366 TACCAAAGTGGGGTGGGGGAAGG - Intergenic
1187768196 X:22666532-22666554 AACAGAATGGGGGTGGGGGCGGG - Intergenic
1187883184 X:23865031-23865053 TAGGGCATGGAGGTGGGGGCAGG - Intronic
1187901031 X:24026566-24026588 TGGCGGCGGGGGGTGGGGGTGGG - Intronic
1188001851 X:24989744-24989766 TAGCCATGGGGGGTGGGGGTGGG + Intronic
1188236811 X:27741406-27741428 TGGGGCATGGGGGTGGGGGCAGG - Intronic
1189288611 X:39869475-39869497 TGGGGTTGGGGGGTGGGGGCAGG + Intergenic
1189333288 X:40155631-40155653 TAGGGAGGGGGTGTGGGGGGGGG + Intronic
1189354240 X:40299153-40299175 TGGCAAAGTGGGGTGGGGGCAGG - Intergenic
1189812618 X:44794609-44794631 GAGAGAAGTGGGGTGGGGCCAGG - Intergenic
1190057964 X:47193016-47193038 TGGAGAGGGGAGGTGGGGGCAGG + Intronic
1190740941 X:53288386-53288408 TAGGGAAGGAGGGAGGGGGTGGG - Intronic
1191185630 X:57607992-57608014 TAGCCAAGGGAGGCGGGGGAGGG - Intergenic
1191270233 X:58456092-58456114 TTGCGGTGGGGGGTGGGGGGAGG - Intergenic
1192139870 X:68638365-68638387 GTGGGCAGGGGGGTGGGGGCAGG - Intergenic
1192464905 X:71347883-71347905 TGGCGATGGGGGGAGGGGGAGGG - Intergenic
1192477225 X:71453385-71453407 TAGAGATTGGGGGTGGGGGGGGG - Intronic
1192563609 X:72144256-72144278 TAGCTAATGGGGGTGGGTGGGGG - Intergenic
1193749626 X:85326411-85326433 TACTGCTGGGGGGTGGGGGCGGG + Intronic
1195495708 X:105530721-105530743 AAGGGTAGTGGGGTGGGGGCGGG - Intronic
1195654700 X:107323779-107323801 TAGGGAGGGTGGGCGGGGGCGGG - Intergenic
1195688304 X:107604273-107604295 TCGGGGAGGGGGGTGGGGGGAGG + Exonic
1196644195 X:118098931-118098953 GGGGGAAGGGGGGTGGGGGAAGG + Intronic
1196918278 X:120561251-120561273 TCGCGAAGGGGAGCGGGAGCAGG - Intronic
1197214404 X:123854781-123854803 GAGTGAAGCGGGGTGGGGGGTGG - Intergenic
1197707888 X:129647221-129647243 TGGGGATGGGGTGTGGGGGCAGG + Exonic
1198028783 X:132734984-132735006 TGGGGATGGGGGGTGGTGGCTGG + Intronic
1198112284 X:133512594-133512616 GAACCAAGGAGGGTGGGGGCGGG - Intergenic
1198388359 X:136148397-136148419 TGGCGAATGGGGGTGGGGAGGGG + Intronic
1198533082 X:137564035-137564057 TAGCCAAGGGCGGTTGGGGTTGG + Intergenic
1198534606 X:137574182-137574204 AAGCGGTGGGGGTTGGGGGCAGG + Intronic
1198764388 X:140065680-140065702 CAGGGAAGGGGGGTGTGGGAAGG + Intergenic
1199834236 X:151573017-151573039 TGGTGACGGGGGGTGGGGGAAGG + Intronic
1200042280 X:153379198-153379220 CAGTGAATGGGGGTGGGGGATGG + Intergenic
1200069189 X:153519458-153519480 TGGCGGCGGGGGGTGGGGGTTGG - Intronic
1200135165 X:153871233-153871255 AGGAGAAGGGAGGTGGGGGCAGG + Intronic
1200787211 Y:7271756-7271778 TAGAGATGGGGGCTGGGGGTGGG + Intergenic
1200807748 Y:7449539-7449561 GAGGAAAGAGGGGTGGGGGCGGG - Intergenic
1201765510 Y:17570653-17570675 TAGCCGAGGGCGGTGGGGGGCGG + Intergenic
1201836042 Y:18335336-18335358 TAGCCGAGGGCGGTGGGGGGCGG - Intergenic
1202124702 Y:21557530-21557552 TAGCGAAGGGAGCTGAGGCCAGG - Intergenic
1202154306 Y:21871850-21871872 TAGCGAAGGGAGCTGAGGCCAGG + Intergenic
1202195281 Y:22294544-22294566 TAGCGAAGGGAGCTGAGGCCAGG + Intergenic
1202379128 Y:24260982-24261004 GAGAGAAGGGAGGTGGGGCCGGG - Intergenic
1202491654 Y:25409139-25409161 GAGAGAAGGGAGGTGGGGCCGGG + Intergenic