ID: 1148357168

View in Genome Browser
Species Human (GRCh38)
Location 17:46983173-46983195
Sequence CCAAATATGCAAATAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148357168_1148357173 7 Left 1148357168 17:46983173-46983195 CCATTGTCTATTTGCATATTTGG 0: 1
1: 1
2: 3
3: 57
4: 389
Right 1148357173 17:46983203-46983225 GAACCATCCACGTCAGGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1148357168_1148357176 18 Left 1148357168 17:46983173-46983195 CCATTGTCTATTTGCATATTTGG 0: 1
1: 1
2: 3
3: 57
4: 389
Right 1148357176 17:46983214-46983236 GTCAGGAGCAGGACCCCATCTGG 0: 1
1: 0
2: 0
3: 15
4: 205
1148357168_1148357177 23 Left 1148357168 17:46983173-46983195 CCATTGTCTATTTGCATATTTGG 0: 1
1: 1
2: 3
3: 57
4: 389
Right 1148357177 17:46983219-46983241 GAGCAGGACCCCATCTGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 256
1148357168_1148357170 1 Left 1148357168 17:46983173-46983195 CCATTGTCTATTTGCATATTTGG 0: 1
1: 1
2: 3
3: 57
4: 389
Right 1148357170 17:46983197-46983219 CTCCCAGAACCATCCACGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148357168 Original CRISPR CCAAATATGCAAATAGACAA TGG (reversed) Intronic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902324165 1:15687939-15687961 GCAAATATAGAAATACACAATGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
909007873 1:70298210-70298232 GCAAATTTGCTCATAGACAATGG - Intronic
909501242 1:76337686-76337708 TCAAATATGCAAATAAACCTTGG - Intronic
909504780 1:76376312-76376334 ACACACATGCAAATACACAAAGG - Intronic
909944760 1:81650913-81650935 CAAAAACTGCAAATAGAAAATGG - Intronic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910814988 1:91282451-91282473 CAAAATAAGGAAATAGAAAATGG - Intronic
911156220 1:94639859-94639881 CCAAATTTTTAAATGGACAAAGG + Intergenic
911295040 1:96104806-96104828 TGACATATGCAAATAGAAAAGGG + Intergenic
911595847 1:99798352-99798374 ACAAAGATGAAAAGAGACAAAGG - Intergenic
911698847 1:100926822-100926844 ACGAACATGCAAATAGATAATGG + Intronic
914994527 1:152530937-152530959 ACAAAGATGAAAAAAGACAAGGG - Intronic
917397318 1:174607734-174607756 CCAATTATCCAAATAGCCACTGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917802268 1:178581524-178581546 CCAAACATGCAAATACCCACAGG - Intergenic
918610317 1:186482556-186482578 CTTAATATGCTAATAGAGAATGG - Intergenic
918637429 1:186795093-186795115 CCCAATTTAAAAATAGACAAAGG - Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919329796 1:196157162-196157184 CCAAATATGTACATTTACAAAGG - Intergenic
919687167 1:200494744-200494766 CCTAATAGGAAAATAGAAAAGGG + Intergenic
921240562 1:213177153-213177175 CCAAATTTGCACATACACAATGG - Intronic
921823266 1:219641441-219641463 CCAAATATTCAAAGAGACTTGGG - Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
1063057266 10:2519441-2519463 CCTAATATCCAAACATACAAGGG + Intergenic
1063278726 10:4601023-4601045 GCAAATATGTAAATAAACAGAGG - Intergenic
1063888959 10:10609296-10609318 CCAAATAAGCAAATTGATGATGG - Intergenic
1064613609 10:17129562-17129584 CCAAATAGCCAGATAAACAAAGG - Intronic
1064658912 10:17585775-17585797 CAAAATATTTAAATAGACATAGG - Intergenic
1065439252 10:25733092-25733114 CCAATTATGAAGATAGTCAACGG + Intergenic
1065535935 10:26714751-26714773 TCAATTTTGCAAATAGCCAATGG + Intronic
1066015351 10:31236805-31236827 CAAAATATGCAAATCAATAAAGG + Intergenic
1066807944 10:39281874-39281896 CCAAATATGCAATCACAGAATGG + Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1068431972 10:56945439-56945461 CCAAACATGAAAACAGACATAGG - Intergenic
1068768051 10:60786424-60786446 TCAAAAATGTAAATAGACATAGG - Intronic
1069182518 10:65379804-65379826 ACAGATATGCAAGTAGACATGGG + Intergenic
1071448492 10:85771702-85771724 GCAAATATCAAAAGAGACAAAGG + Intronic
1071670383 10:87603724-87603746 CAAAATATTCAAAGAGATAAAGG - Intergenic
1072045794 10:91653531-91653553 CCAAAAATGCAAATGCACACGGG + Intergenic
1073698385 10:105895816-105895838 ACAAAGATGAAAAAAGACAAGGG + Intergenic
1073894257 10:108136356-108136378 CCAACTATGCACCTAGAAAAGGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1079415086 11:20226831-20226853 CCAAATTTACAAATAGACTAGGG - Intergenic
1079551591 11:21705579-21705601 CCATATATGCAAATTCCCAATGG + Intergenic
1079813858 11:25030100-25030122 ACAAATATGCAAACACACAAAGG - Intronic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080292116 11:30682713-30682735 CCAAATAACCAAATAGAGAGTGG + Intergenic
1080382658 11:31790272-31790294 CCAAACATGCAAACAAACAGAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082973928 11:59053795-59053817 GCACCTATGCAAATAGAAAAGGG + Intergenic
1082978339 11:59097605-59097627 GCACCTATGCAAATAGAAAAGGG + Intergenic
1084967234 11:72751156-72751178 TCCAATATGCAAGTAGCCAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086582853 11:88419510-88419532 AAAAATATGAAAAAAGACAAAGG - Intergenic
1086655306 11:89347189-89347211 ACAAATATGCAGACACACAAGGG + Intronic
1086743522 11:90397961-90397983 CCAAATAACCAATTAGAAAATGG + Intergenic
1087233498 11:95692700-95692722 CCAAGTATGTACATAGACAGAGG - Intergenic
1087582754 11:100079583-100079605 GCAAATAGACAAATAGACATGGG + Intronic
1087909411 11:103736024-103736046 CCAAAAATGCAAATTAAGAAGGG + Intergenic
1088167341 11:106954761-106954783 ACAAAAATACAAAAAGACAAGGG - Intronic
1088715312 11:112543820-112543842 CCAAGTGTGCAAATATAAAAGGG - Intergenic
1091293004 11:134452571-134452593 CCACAAATGCTGATAGACAAAGG - Intergenic
1091967055 12:4753841-4753863 CCAGATATTCAAAAAGACATGGG + Intronic
1092680908 12:10979998-10980020 TCAAATATGCTATTAGAGAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093544176 12:20326823-20326845 ACAAATAGGCTAAAAGACAAAGG - Intergenic
1093618601 12:21259310-21259332 CAACATATGCAAATCAACAAAGG - Intergenic
1093754363 12:22835856-22835878 ACAAATGAGCAACTAGACAATGG + Intergenic
1094052513 12:26236747-26236769 CCAAATATGTAAAACAACAAAGG - Intronic
1094395133 12:29997450-29997472 CCAAATTGGCAAATATAAAAAGG + Intergenic
1094755647 12:33465115-33465137 ACAAAGATCAAAATAGACAAAGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095396797 12:41771067-41771089 TCAAATAGACAAATAGACAGTGG + Intergenic
1095421834 12:42032130-42032152 CTAAATAAGCAAGTACACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097358462 12:58629903-58629925 CAATATTTCCAAATAGACAAAGG - Intronic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099556904 12:84120532-84120554 GCAAATCTGCAAATAGAGCAGGG - Intergenic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1100954056 12:99886401-99886423 ACAAATGTGCAAAAACACAATGG + Intronic
1102514030 12:113434710-113434732 CCAACTTTGCAAAGAGGCAATGG - Intronic
1102703907 12:114864617-114864639 CCAAACAGGCACACAGACAAGGG - Intergenic
1102725186 12:115057672-115057694 CCAAATTTGATAAAAGACAAGGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104772074 12:131369713-131369735 CCAAATGTGCACATACATAAGGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1107103421 13:36618446-36618468 CCAAATATACAAAAAAAGAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109724911 13:66327298-66327320 CCAAATATGGAACTAGATACTGG - Intronic
1110454357 13:75673459-75673481 CCAAATAGGAAAAGAGAGAAAGG - Intronic
1110571618 13:77011035-77011057 CCAAATTAGAAAATAGGCAAAGG + Intronic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1110746513 13:79059986-79060008 GAAGATATGCAAATACACAATGG - Intergenic
1110788696 13:79562913-79562935 ACAAAGATGAAAAAAGACAAGGG + Intergenic
1111291759 13:86180550-86180572 CCCAATATGAAAAAAGACAAAGG - Intergenic
1113475595 13:110578561-110578583 CCAACCATGGAAATAGACACTGG + Intergenic
1113571979 13:111364522-111364544 CCAAATTTAAAAATTGACAAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114729030 14:24971283-24971305 CAAAATATGCATCTAGACATGGG - Intronic
1114746144 14:25149559-25149581 TAATATATGCAAATAAACAATGG - Intergenic
1116282185 14:42923449-42923471 CCAAATAAGTGAATAGACACTGG - Intergenic
1116433085 14:44868728-44868750 CCAGATAAGCAAATAAGCAATGG + Intergenic
1117793955 14:59372131-59372153 CCAAATATACAAATAGGCAGTGG - Intergenic
1118105719 14:62657322-62657344 CCAAAGACGAAAGTAGACAATGG + Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1120130242 14:80798342-80798364 CAAAATAAGCAAAGAGAAAAAGG + Intronic
1120280383 14:82431168-82431190 GTAAAAATGCAATTAGACAAAGG - Intergenic
1120358336 14:83462041-83462063 CCAAATAAGAAAATTTACAATGG + Intergenic
1121403145 14:93700112-93700134 CAATATAAGCAAAAAGACAATGG - Intronic
1122250291 14:100434298-100434320 ACAAATATGGAAATGGAAAAGGG - Intronic
1122434548 14:101685632-101685654 CCTGATATGAAAATGGACAAAGG + Intergenic
1123798309 15:23795983-23796005 TCAAAGATTCAAAGAGACAAAGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1125108435 15:36002286-36002308 TGAAATATGAAAATAGTCAAGGG - Intergenic
1125498404 15:40219838-40219860 TCAAAGATGAAAATAGAGAAGGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126384434 15:48079329-48079351 CCCAATAAGAAAATAGACAAAGG + Intergenic
1126717425 15:51534038-51534060 CCAAATGTACAAATACAGAATGG + Intronic
1127013711 15:54659309-54659331 CAAAATATCCAAATAGAAATTGG + Intergenic
1129077892 15:73013124-73013146 CCAAATATGAATATTGGCAAAGG + Intergenic
1130392363 15:83469361-83469383 GAAAATATGCAAATAAACTAAGG - Intronic
1131422021 15:92314805-92314827 ACATATATGCAAATAGACAAGGG + Intergenic
1131778733 15:95830865-95830887 CCAAATATGCCTAGAGAAAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131978242 15:97967843-97967865 CCAAATATGCACAAAAACACAGG - Intronic
1133333872 16:4994006-4994028 GCAAATAAGAAAATGGACAAAGG - Intronic
1133515152 16:6501642-6501664 CCAAACATTCTTATAGACAAGGG + Intronic
1133677132 16:8084513-8084535 CCAGAGAGGCAAATAGAAAAGGG - Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1139055891 16:63183260-63183282 CAAAATATTTAAATAAACAATGG - Intergenic
1139971378 16:70777715-70777737 GCAAATATGCACACACACAAAGG + Intronic
1140622778 16:76756221-76756243 ACAAATATGCAAATAGGTAGTGG - Intergenic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1143988260 17:10934262-10934284 ACAAATATGCAAATCTAAAAAGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144061666 17:11588415-11588437 CATACTATGCAAATAAACAAAGG - Intergenic
1144423602 17:15120306-15120328 GCACATAAGCAAATAGACGAAGG + Intergenic
1144464262 17:15484059-15484081 CCAAACATGCAAACACACGAAGG + Intronic
1145183893 17:20777547-20777569 GAAGATATGCAAATGGACAATGG - Intergenic
1146417730 17:32652454-32652476 ATAAATATGGCAATAGACAAAGG - Intronic
1147026715 17:37592110-37592132 CAAAAAATGCAATTAGAAAATGG + Intronic
1147525520 17:41218583-41218605 ACAAATATCAAAAAAGACAAAGG + Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1149827812 17:59845747-59845769 TTAAATATGCAAATACACACAGG - Intergenic
1151531119 17:74705431-74705453 ACAAATTTGCAATTTGACAAAGG - Intronic
1153162659 18:2226308-2226330 AAAGATATGCAAATACACAATGG - Intergenic
1155567342 18:27149937-27149959 TTAAATATGCAAAGAGATAAAGG - Intronic
1157031993 18:43922281-43922303 TCAAATATTCAAATAAAAAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158034581 18:53010398-53010420 CTAAATATGCAAATAAATATTGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158793581 18:60813258-60813280 CTAATGATGAAAATAGACAATGG + Intergenic
1158827042 18:61233876-61233898 GCAAACATGCAAGTAGAAAAGGG + Intergenic
1159957300 18:74528532-74528554 CCAATTTTGAAAATGGACAAAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164693779 19:30228557-30228579 CCAATTATGCAAATGGACTCCGG - Intronic
1166156416 19:40915050-40915072 ACAAAGATGAAAAGAGACAAAGG + Intergenic
1168483583 19:56741482-56741504 CCAAATATACATACAGGCAATGG - Intergenic
1168514329 19:56998363-56998385 CCGAATGTGCAAATGCACAAGGG + Intergenic
926545733 2:14236977-14236999 GAAAAAATGCAAATAGACTAAGG + Intergenic
926824015 2:16884192-16884214 TCAAATATGAATAAAGACAAAGG - Intergenic
927410823 2:22824299-22824321 CCAGATAGGTAATTAGACAAAGG + Intergenic
928535533 2:32236530-32236552 CCAAATGGGCAAATAGTCATTGG + Intronic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
928673161 2:33622758-33622780 CCAAATATGCACCTACACATTGG + Intergenic
929183837 2:39072221-39072243 CCAAAAAAGGAAACAGACAAGGG - Intronic
929364225 2:41132784-41132806 GCTAATGTGAAAATAGACAATGG + Intergenic
929898919 2:45984761-45984783 CCAAATCTGGAATCAGACAAGGG - Intronic
930132975 2:47871642-47871664 CCTAATATAAAAATACACAAAGG - Intronic
930389136 2:50738008-50738030 CCAAATATGCAAATCCAAAAAGG + Intronic
931184281 2:59934676-59934698 CGAAATATGAACATAGACAGAGG + Intergenic
932541251 2:72655396-72655418 CCATAAATGCAAGAAGACAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933873522 2:86594737-86594759 CCCATTATGCACATAAACAAAGG + Intronic
935121721 2:100188869-100188891 CAAAATGTGCATATACACAATGG - Intergenic
935390594 2:102548351-102548373 CCAAATATGGAAATATTCAAAGG + Intergenic
935504862 2:103888098-103888120 GCATATATGCATATACACAATGG + Intergenic
935576444 2:104716590-104716612 CCAGATATTCAAAAAGACATGGG + Intergenic
936726658 2:115326722-115326744 AAAAATATTAAAATAGACAAAGG + Intronic
937442126 2:121925461-121925483 TCAAATATGGAAATAGCAAAAGG - Intergenic
937682819 2:124662923-124662945 TAAAATATGGAAATAGAAAAAGG + Intronic
937687663 2:124716223-124716245 CCAAATATTTAAATAAACACTGG + Intronic
938177370 2:129146103-129146125 CCAATTTTAAAAATAGACAAAGG - Intergenic
938640504 2:133273363-133273385 CCCAATGTGAAAATGGACAAAGG - Intronic
939470527 2:142615021-142615043 CTAAATATGCAAAGAAAGAAAGG + Intergenic
939506992 2:143057634-143057656 ACCAATATGCTGATAGACAACGG - Intergenic
939531311 2:143365228-143365250 CCAAAGATGAAAACAGAAAAAGG - Intronic
939561732 2:143740316-143740338 CCTAATATGCAGACAGACAGTGG - Intronic
940150886 2:150599169-150599191 CCAAACTTGCTAACAGACAAAGG + Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941811283 2:169758243-169758265 CCTAATATGCAAAAAGACCTGGG - Intronic
941953752 2:171183483-171183505 CCAGATAGGAAAGTAGACAAAGG - Intronic
942686664 2:178539844-178539866 CCCAATATGTAAATGGACCAAGG - Exonic
943242403 2:185402009-185402031 AAAAATAAGCAAAGAGACAAGGG + Intergenic
943469758 2:188279020-188279042 CCAAATAAACAAATAAAAAAGGG - Intergenic
943757805 2:191575204-191575226 GCACACATGCAAATAGATAAAGG + Intergenic
945586258 2:211667402-211667424 CAAAATAGTGAAATAGACAAGGG - Intronic
946982367 2:225231255-225231277 CCAAATATGCAAATAGGGAAAGG + Intergenic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
947481551 2:230505105-230505127 CCAAACTTGCATATGGACAATGG + Intronic
1169612048 20:7392537-7392559 CCAAGTATGCACAAACACAAGGG + Intergenic
1170548970 20:17459314-17459336 CCAAATATCCATTTATACAATGG - Intronic
1171127115 20:22612024-22612046 ACAAATATGCAAGTAAACAGGGG - Intergenic
1172300205 20:33844473-33844495 GCAAATACGCAAATATACCAGGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174838952 20:53883833-53883855 GCACATTAGCAAATAGACAACGG - Intergenic
1176229285 20:64023558-64023580 CCAGAAAAGCAAAGAGACAATGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177888421 21:26775105-26775127 ACAAATATGAACACAGACAAAGG - Intergenic
1178217725 21:30620253-30620275 TCAAATATGCAAACAGAAACTGG - Intergenic
1178481539 21:32983358-32983380 GCAAATAAGCAAATATACCAAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1182225813 22:28797968-28797990 CAATATATGCAAATTGACCAAGG + Intronic
1183399068 22:37590589-37590611 CCAAGTATGCACATACCCAAAGG + Intergenic
949933634 3:9099864-9099886 CCAAATACTCAAATGCACAAAGG + Intronic
950897614 3:16467677-16467699 CCAGAGATGCAAAAAGCCAACGG + Intronic
951296999 3:20949838-20949860 ACAAAGATCCAAAAAGACAAAGG - Intergenic
952732259 3:36650951-36650973 CCAAATAGACAATTAGAGAATGG + Intergenic
955756113 3:62226827-62226849 CCACATATGCAAATAGGAAAAGG + Intronic
956241888 3:67140165-67140187 TCAAAGATGAAAAGAGACAAGGG - Intergenic
956335019 3:68154082-68154104 CCAAATAAGCAATCAGACAATGG - Intronic
956438602 3:69258635-69258657 TCAAATAGGCAAGTAAACAAAGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956729271 3:72182080-72182102 GCAAAGAGGCAAAGAGACAAAGG - Intergenic
956853828 3:73256640-73256662 ACAACTATGCCAATAGAAAATGG - Intergenic
957487988 3:80887713-80887735 CCAAATATGTCAATACAGAATGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957903033 3:86521701-86521723 CAGAATATGCAAAAAGACTAGGG - Intergenic
958434280 3:94078694-94078716 ACAAAGATCAAAATAGACAAGGG - Intronic
958700892 3:97587753-97587775 CCAAGTAAGCAAATAGAATATGG - Intronic
958966115 3:100560716-100560738 CGAAATATTCAAATAAAGAAAGG + Intronic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960422713 3:117467004-117467026 CCACATAACCAATTAGACAAGGG + Intergenic
960839964 3:121947396-121947418 GCATATATGCAACTTGACAAGGG - Intergenic
961499901 3:127324778-127324800 CCAAATAGGAAAATGGCCAAAGG + Intergenic
963053921 3:141168028-141168050 TGAAATCTGCAAAAAGACAATGG - Intergenic
963172327 3:142263502-142263524 CCTAATTTAAAAATAGACAAAGG - Intergenic
963868667 3:150389867-150389889 CCAGATTTGGAAAGAGACAATGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965677609 3:171214312-171214334 CCAAAAATGCAAAGAGAGCAAGG + Intronic
966536125 3:181036216-181036238 CCAAATAAGTACATTGACAATGG - Intergenic
968773991 4:2528093-2528115 CCCAATTTGAAAATGGACAAAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970585029 4:17507016-17507038 ACAAATAAGCAAAAAGAAAAGGG - Intronic
970774658 4:19658984-19659006 GCATATATGCAAATACATAAGGG + Intergenic
971184883 4:24364975-24364997 CCACATATGCAAGGAGACTAAGG + Intergenic
971293584 4:25368924-25368946 CCAAATAAGAAAATAGAAGAAGG - Intronic
971462365 4:26914486-26914508 ACAGATATACAAATAAACAATGG - Intronic
971717618 4:30199758-30199780 CCCAATTTAAAAATAGACAAAGG - Intergenic
971740976 4:30520751-30520773 ATAAATATGGAAATATACAAAGG - Intergenic
972447198 4:39156168-39156190 CCAATTTTGAAAATGGACAAAGG + Intergenic
972503075 4:39696133-39696155 GCAAACATGGAAATAGCCAATGG - Intergenic
973387787 4:49524953-49524975 CCAATTAAAAAAATAGACAAAGG - Intergenic
973777970 4:54260846-54260868 CCAAACACTCAAATAGACAGAGG - Intronic
974178010 4:58348907-58348929 CCAATTATAAAAAAAGACAATGG + Intergenic
975027548 4:69569932-69569954 ACAAATATGCTAATTGAAAATGG - Intergenic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
975621465 4:76300828-76300850 CTAAGTATGCACATAGCCAATGG - Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
977210971 4:94217328-94217350 CCAAAGATGCAAACAAACATGGG - Intronic
977526792 4:98155916-98155938 CCAAATTTGCAACTACCCAATGG - Intergenic
977763467 4:100769852-100769874 CCACATATACAAACACACAAAGG - Intronic
977874373 4:102131213-102131235 CCGAATATGAAAATTCACAATGG - Intergenic
977902213 4:102435809-102435831 CCCAATATGAAAATGGGCAAAGG + Intergenic
978123908 4:105112436-105112458 GCAAATATGCATATTGAGAATGG - Intergenic
978488262 4:109281017-109281039 ATAAATATGTAGATAGACAAAGG + Intronic
978721265 4:111912411-111912433 TCAAATATGGAAATAGACCTGGG - Intergenic
978957187 4:114628552-114628574 CCAAATATGCATATAAACAGGGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
979735801 4:124082032-124082054 CTAAATATCACAATAGACAAAGG + Intergenic
979886820 4:126037525-126037547 CCAGACATGCAAAAAGACAATGG - Intergenic
981224358 4:142275498-142275520 CCAAACATAAAAATAAACAAGGG + Intronic
982420833 4:155195272-155195294 GCAAATATGCCAATAAATAAAGG - Intergenic
983606155 4:169587371-169587393 CCAGATATGCATATATACAAAGG + Intronic
983660736 4:170128363-170128385 CAAAAGATTAAAATAGACAATGG - Intergenic
984798499 4:183689494-183689516 CCAAATAATCACACAGACAACGG - Intronic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985586913 5:745193-745215 CCATACGTGCAAATGGACAAAGG - Exonic
985601488 5:837375-837397 CCATACGTGCAAATGGACAAAGG - Exonic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
987894741 5:23929901-23929923 CCAAATATGGTAATAGAAAAGGG - Intergenic
988350007 5:30090788-30090810 CCATAGATGCAAATAAAGAAAGG - Intergenic
988417885 5:30969298-30969320 CAAAATATGCAAAGAAACAGTGG + Intergenic
990244473 5:53850657-53850679 CAACATATGCAAATAAATAAAGG - Intergenic
990686569 5:58309560-58309582 CCAAATAAACAAACAGAAAAAGG - Intergenic
990762971 5:59150959-59150981 CCAGATATATAAATAAACAAAGG + Intronic
991687562 5:69195561-69195583 CCAAATGTGTAAATACACATTGG + Intronic
993458169 5:88149018-88149040 CTAAATAGTCAAATAGACATTGG - Intergenic
994319175 5:98370469-98370491 GCAAATATCCAAATATCCAAAGG - Intergenic
994830594 5:104777384-104777406 TCTAAAATGCAAATAGATAAAGG - Intergenic
995721852 5:115143641-115143663 GCATATATGCAATTAGACAGAGG + Intronic
995933980 5:117486209-117486231 ACAAGTATGCAAATAGAAAGAGG - Intergenic
996160948 5:120164027-120164049 AGAAAAAAGCAAATAGACAAGGG - Intergenic
997673356 5:135694415-135694437 CTAAATATGTAAATATATAAAGG - Intergenic
998696827 5:144650420-144650442 ACAAATATAGAAATAGAGAAGGG + Intergenic
998923078 5:147092314-147092336 CCCCATATGCAAATGGAGAAAGG + Intergenic
998928221 5:147151454-147151476 AAAGATATGCAAATAGCCAACGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
1001351653 5:170973796-170973818 CCAACTATGAAAACAGAAAAGGG - Intronic
1002067724 5:176660561-176660583 TCAGATATGCAAAAACACAAGGG + Intergenic
1002533083 5:179860304-179860326 GACAATATGCCAATAGACAATGG + Exonic
1003614674 6:7644363-7644385 CCAAAGATGCAATTTTACAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1005689789 6:28292733-28292755 CCATATTTGCAAATTGACCAAGG + Intronic
1006287820 6:33111295-33111317 AAAAATAGGCACATAGACAAAGG - Intergenic
1006712416 6:36085552-36085574 GCAAATATCAAAAAAGACAAGGG + Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1008210067 6:48711302-48711324 CCAAATATGTAAATAAATAGAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009409899 6:63354123-63354145 ACAAAAATAAAAATAGACAATGG + Intergenic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010089256 6:71960759-71960781 CTAAATATTCAAGTAGACATGGG + Intronic
1010162664 6:72876834-72876856 CCAAATCTGCAAACATACCAAGG - Intronic
1011161514 6:84396173-84396195 CCAAATCCCCAAATAAACAAGGG - Intergenic
1011186936 6:84687969-84687991 CCAAATGTGCAAATATAGGAGGG - Intronic
1011246871 6:85328743-85328765 CCAAATAAGCACACAGCCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011637444 6:89387391-89387413 CCAAATCTGAAAATTGACAAAGG + Exonic
1011721389 6:90160321-90160343 CCACACATGCACATACACAAAGG - Intronic
1011831416 6:91376481-91376503 CCACAAATGCAAAATGACAAGGG + Intergenic
1012884489 6:104830392-104830414 CAAAAAATGCAAATGAACAATGG + Intronic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1013851489 6:114521275-114521297 TCAAATATTCAAATATAAAACGG + Intergenic
1014009040 6:116455932-116455954 CCAAAACTGCTAATAGACATAGG + Intergenic
1014062514 6:117089460-117089482 CTAAATATGCAAATACAATATGG + Intergenic
1014589460 6:123245475-123245497 ACAAAGATGAAAAGAGACAAAGG + Intronic
1014599950 6:123398809-123398831 CCAGATATGCAAATTGCAAAAGG + Intronic
1015033226 6:128621994-128622016 CCAAATGAAAAAATAGACAAAGG + Intergenic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016798238 6:148141127-148141149 ACAAACATGCAAAGAGACCAAGG - Intergenic
1016932996 6:149427811-149427833 CCAGATCTGAAAATAGACACTGG + Intergenic
1017740785 6:157404865-157404887 CCTAATAAGAAAATAGTCAATGG - Intronic
1018192583 6:161323404-161323426 ACAAACATGCAATTAGATAAAGG + Intergenic
1020362069 7:7337692-7337714 ACAAAAATGAAAATTGACAATGG - Intergenic
1020588816 7:10107774-10107796 CAAAATATGGAATTAGAAAATGG - Intergenic
1020829285 7:13073437-13073459 ACAAATATACAACTAGAAAATGG - Intergenic
1020927097 7:14343201-14343223 CAAGATATGCAAAAATACAAGGG + Intronic
1021121334 7:16799033-16799055 CAAAATATGGAAAGAGAAAAGGG + Intronic
1021347432 7:19546009-19546031 ACAAATATCAAAAAAGACAAAGG - Intergenic
1021634493 7:22678348-22678370 CAAAACATTCAAATAAACAATGG - Intergenic
1021887188 7:25150974-25150996 CCAAATATGCAGAGAGTAAATGG - Intronic
1021981100 7:26056346-26056368 TCAAATATGCAAAAAGAAAAAGG - Intergenic
1022579600 7:31537383-31537405 ACAAATATGAAAACAGACATGGG + Intronic
1022903190 7:34830579-34830601 CAACATATGCAAAAAGAAAAAGG - Intronic
1023203856 7:37726960-37726982 TCACGTATGCAAATAGAAAATGG + Intronic
1023557543 7:41438829-41438851 GCAAGTATGCAAATAGCAAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024026071 7:45410962-45410984 CCAAATAAGGAGTTAGACAAAGG - Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024723818 7:52169507-52169529 CCAAATTTGAACATAGGCAAAGG + Intergenic
1025245659 7:57314877-57314899 CAAAAGATGCAAATAGCAAAAGG + Intergenic
1025528463 7:61844941-61844963 CCAAATATGCATACACAGAATGG + Intergenic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1028326679 7:89535746-89535768 CAAAATATGCAAACAGAGGAGGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1030601858 7:111602065-111602087 CCAAAGAGGCAAAAAGACAGGGG + Intergenic
1030657967 7:112189199-112189221 CCAAATATGCAATTAGCCATTGG - Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1034442533 7:151093727-151093749 CCAAATACGCAAATGAACACGGG - Intronic
1034605576 7:152310164-152310186 TCTAATATGTAAATATACAATGG + Intronic
1034693872 7:153036949-153036971 ACAAATAAGCATATGGACAAAGG - Intergenic
1034890333 7:154833783-154833805 CCAAAGATTCTCATAGACAAAGG + Intronic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1035998062 8:4571881-4571903 ACAAAGATCCAAAAAGACAAGGG - Intronic
1036479269 8:9123812-9123834 CCATATATGCAAACACACAAAGG + Intergenic
1037012258 8:13858070-13858092 CCAATTAAGAAAATAGAAAAAGG + Intergenic
1037213618 8:16422814-16422836 CCAAATATGCAAAAATATGAGGG + Intronic
1038288729 8:26229360-26229382 ACAAGTATGCAAAGAGATAAGGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038880775 8:31608398-31608420 CCAAATATGCAAAAAGAAAGAGG - Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040138751 8:43885538-43885560 CAAAATATTAAAACAGACAATGG - Intergenic
1040742462 8:50594791-50594813 ACAAATATGGAAATTCACAAAGG + Intronic
1041015576 8:53590345-53590367 CCAAATTTGCAAAGACACACAGG + Intergenic
1041873113 8:62657942-62657964 CCAAATAACCAAAAAGACAAAGG + Intronic
1043705958 8:83351067-83351089 GAAAATATGCAAATAGCCAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044303246 8:90609358-90609380 CCAAATATGTAACTACCCAATGG - Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044615399 8:94135418-94135440 ACAAAGATGAAAAGAGACAAAGG - Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1046490162 8:114941446-114941468 CCAGATATGCAAATGCTCAAGGG - Intergenic
1047096900 8:121635720-121635742 CCAAATATTTAAACACACAAAGG + Intronic
1047280932 8:123444890-123444912 GCAAATATGAAAATATAAAATGG + Intronic
1048485425 8:134843686-134843708 CAAAATATTAAAATAGACAGAGG - Intergenic
1050200968 9:3145662-3145684 ACAAAGATGAAAAAAGACAAAGG - Intergenic
1050970252 9:11861934-11861956 CCAAATATACAAATAAACTTAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052662219 9:31448597-31448619 CCAAGTATAAAAATTGACAATGG + Intergenic
1052854053 9:33396071-33396093 CCAAATCTGCATATAGAGAGAGG + Intronic
1053636613 9:40012765-40012787 ATAAATATGCAGAAAGACAAAGG + Intergenic
1054839050 9:69715872-69715894 GCAAAAATGCAAATACCCAAAGG - Intronic
1055199156 9:73637043-73637065 GCAAATATAAAAATAGCCAATGG + Intergenic
1055220499 9:73924904-73924926 CACAATGTGCAAATAGTCAAGGG - Intergenic
1055812989 9:80172703-80172725 CAAAATATGCATATAAACATTGG + Intergenic
1056240082 9:84636656-84636678 CCAAATATCTAAAATGACAATGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059730568 9:117053039-117053061 CCAAATATAGAAAGAGAAAAAGG + Intronic
1059739355 9:117134595-117134617 GAAAATATGCAAATACACATAGG - Intronic
1059923638 9:119185321-119185343 CAAAATATGCACCTAGACAGCGG + Intronic
1059990141 9:119857538-119857560 CCTTATATTCAAATACACAATGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186081245 X:5935555-5935577 CCAAATATGCACATAAAATATGG + Intronic
1186318205 X:8394034-8394056 CTAAAGATGAAAATAGATAATGG + Intergenic
1187149029 X:16664957-16664979 CCTAATTTTAAAATAGACAAAGG + Intronic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188615140 X:32149063-32149085 CAAAATATGAAAGTAGAAAAAGG + Intronic
1189235163 X:39481229-39481251 CCAAATATACATATAGTCATAGG + Intergenic
1189493687 X:41490323-41490345 CCAACAATGCAATTAGAAAATGG + Intergenic
1191592177 X:62899197-62899219 ACAAAGATGCAAATACACATTGG - Intergenic
1191709103 X:64129736-64129758 CCAAAAATGCAATTAAATAATGG + Intergenic
1191839948 X:65505130-65505152 CGAAATATTGAAATATACAATGG - Exonic
1191910966 X:66149075-66149097 CCAAAGATGCAGAGAGACAAAGG + Intergenic
1193186701 X:78521888-78521910 ACAAATATGTAGATAGAAAAGGG + Intergenic
1193655582 X:84193150-84193172 ACAAATATGCAGATGGATAAAGG - Intergenic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1194847134 X:98824262-98824284 GAAAATATGCATACAGACAAAGG + Intergenic
1195107847 X:101617579-101617601 ACAAACCTGCAAACAGACAAGGG + Exonic
1195583050 X:106530615-106530637 TCTAATATGCCAATAGACCATGG + Intergenic
1196269562 X:113695673-113695695 ACAAATATTAAAAGAGACAAGGG - Intergenic
1197105763 X:122713271-122713293 TCAAATAAAAAAATAGACAAAGG + Intergenic
1197318863 X:125003367-125003389 CCAACTATTCAATTAGAGAAAGG + Intergenic
1199183242 X:144883348-144883370 AAAAATAGGCACATAGACAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1201751995 Y:17442851-17442873 ACAAATATCAAAAGAGACAAAGG - Intergenic