ID: 1148358903

View in Genome Browser
Species Human (GRCh38)
Location 17:46995872-46995894
Sequence CAGTGTAAGGAGGAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 453}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148358894_1148358903 -8 Left 1148358894 17:46995857-46995879 CCTTGGTCACCTGCCCAGTGTAA 0: 1
1: 1
2: 1
3: 9
4: 146
Right 1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 49
4: 453
1148358892_1148358903 -4 Left 1148358892 17:46995853-46995875 CCCGCCTTGGTCACCTGCCCAGT 0: 1
1: 0
2: 2
3: 38
4: 304
Right 1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 49
4: 453
1148358889_1148358903 11 Left 1148358889 17:46995838-46995860 CCTTGGTCCTGAGTTCCCGCCTT 0: 1
1: 0
2: 0
3: 9
4: 185
Right 1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 49
4: 453
1148358891_1148358903 4 Left 1148358891 17:46995845-46995867 CCTGAGTTCCCGCCTTGGTCACC 0: 1
1: 0
2: 2
3: 5
4: 132
Right 1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 49
4: 453
1148358893_1148358903 -5 Left 1148358893 17:46995854-46995876 CCGCCTTGGTCACCTGCCCAGTG 0: 1
1: 0
2: 2
3: 27
4: 239
Right 1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 49
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148358903 Original CRISPR CAGTGTAAGGAGGAGGGGCC TGG Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
902410060 1:16207132-16207154 CAGCGCGAGGAGGAGGGCCCGGG - Exonic
902527403 1:17068193-17068215 CAGTGGAAGGAGGAAGGTCAGGG + Exonic
902655934 1:17868365-17868387 GAGAGAAGGGAGGAGGGGCCAGG - Intergenic
902864580 1:19269678-19269700 CCCTGTAAGGAGAAGGGCCCCGG + Intergenic
902888623 1:19425200-19425222 CATTGTATGAAGGAGGTGCCTGG - Intronic
902970518 1:20044814-20044836 CAGTCTAGGGAGGAGGGGAGAGG + Intronic
903138857 1:21326645-21326667 CAGCGTAGGGAGGTGGGGCGAGG + Intronic
903140752 1:21337887-21337909 CAGTGTGGGGAGGAGAGGGCAGG - Intronic
903300003 1:22372036-22372058 CAGTGCCCGGAGCAGGGGCCGGG - Intergenic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
905239619 1:36573155-36573177 CACTGTGTGGGGGAGGGGCCTGG + Intergenic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
906056983 1:42924995-42925017 CAGGGCAAGAAGGAGAGGCCGGG - Intergenic
906253923 1:44332830-44332852 CTTTGGAAGGAGGAGGGGCAAGG + Intronic
907317817 1:53583729-53583751 TATTGCGAGGAGGAGGGGCCGGG + Intronic
907656160 1:56343421-56343443 CAGTGTACTGAGGAGGGGGCTGG - Intergenic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
917600693 1:176570909-176570931 CAGTGTAGGGAGGCAGGGTCAGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918212885 1:182367236-182367258 CAGTCAAAGGAGGAGAAGCCAGG + Intergenic
918907431 1:190515054-190515076 CAGTGTAGGCAGATGGGGCCTGG + Intergenic
919106597 1:193159650-193159672 CAGTGAAAGGAGGCCGGGCACGG - Intronic
920927559 1:210357169-210357191 CAGTGCAAGGAGGAAGGGATAGG - Intronic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
1062836404 10:639012-639034 GAATGCAAGGAGGAGGGTCCAGG - Intronic
1062923991 10:1300431-1300453 CAATGTCAGGAGGAGAGGCGTGG - Intronic
1063306985 10:4911359-4911381 ATGTGCAAGGGGGAGGGGCCTGG + Intergenic
1063307462 10:4918358-4918380 ATGTGCAAGGGGGAGGGGCCTGG - Intergenic
1064551840 10:16509215-16509237 TAGTGTAAGCAGGACGGGGCAGG + Intronic
1066610674 10:37244886-37244908 CAGAGTGAGGAGTTGGGGCCTGG - Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069513907 10:69062446-69062468 CAGTGAAAGCTGGAGGGACCAGG + Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069838805 10:71326597-71326619 CAGTGGACAGAGGAGGGGCAGGG - Intronic
1070682612 10:78459454-78459476 CAGTGAAAGGAGGTCTGGCCTGG + Intergenic
1070811676 10:79301231-79301253 AAGGGTAGGGAGGAGGGGCCAGG - Intronic
1071474939 10:86017990-86018012 CTGTGTGAGGAGGAGGGACGTGG - Intronic
1071686186 10:87760237-87760259 CAGTGTTAGGGGGAGGGACCTGG + Intronic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072811710 10:98467506-98467528 GAGAGAAAGGAGGAGGGGCAGGG + Intronic
1073050649 10:100664949-100664971 CAGGGTAAGGAGGACAGGCGGGG - Intergenic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075439682 10:122469753-122469775 CAGTGCAAGGAGGCAGAGCCAGG + Intronic
1075614924 10:123883887-123883909 CAGTGTGCAGAGAAGGGGCCAGG + Intronic
1076302879 10:129441327-129441349 CAGTCTCAGGACGAGGAGCCAGG - Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1076977418 11:184839-184861 CAGTGTTAGGAGGATTGGTCAGG - Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1077241439 11:1512731-1512753 CAGCGCTAGGAGGTGGGGCCTGG + Intergenic
1077360302 11:2137850-2137872 CTGGGTAACGAGGAGGGGCGCGG - Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1080116305 11:28624872-28624894 CAATGTTAGGAGGTGGGGCCTGG - Intergenic
1081042018 11:38224783-38224805 GAGCATAAGGAGGTGGGGCCAGG - Intergenic
1081869696 11:46377673-46377695 CAGTGCAATGACGGGGGGCCTGG - Intronic
1082004463 11:47412069-47412091 CAGTGCCAGGAGTGGGGGCCTGG + Intronic
1083031387 11:59596141-59596163 CAGTGTAGGGAAGAGGGCTCTGG - Intronic
1083357549 11:62078164-62078186 CTGTGTTAAGAGGTGGGGCCTGG - Intergenic
1083636394 11:64123114-64123136 CAGTGCTGGCAGGAGGGGCCGGG + Intronic
1083680386 11:64349001-64349023 CAGTGAAAGGTGGATGCGCCCGG - Intronic
1083996133 11:66273578-66273600 AAGAGTAAGGAGGAGAGTCCAGG - Intronic
1084288804 11:68148550-68148572 CCTTGGAAGGAGGAGAGGCCCGG + Intergenic
1084890439 11:72234162-72234184 CAGAGCAAGGAGGCAGGGCCAGG - Intronic
1085018375 11:73189928-73189950 CAGTGTGAGGATGAGGCACCTGG - Intergenic
1085201268 11:74703654-74703676 CAGTGTCAGGGAGAGGGGACAGG - Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085413469 11:76305611-76305633 CAGTGCAAGGAGGAGGCACTTGG - Intergenic
1086542690 11:87931876-87931898 TACTGTAAGCAGAAGGGGCCAGG + Intergenic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087732698 11:101796849-101796871 CAGTGGGTGGAGGTGGGGCCTGG + Intronic
1088918215 11:114242968-114242990 CAAGGTAAGGAGGCTGGGCCAGG + Intronic
1089596470 11:119584174-119584196 CAGGCCAAGGAGGAGGGGCTAGG - Intergenic
1089642849 11:119859132-119859154 CAGGGTTAGGATGAGGGGGCAGG + Intergenic
1090334189 11:125951762-125951784 CTGTGGAAGGAGGAAGGGCTTGG - Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090516351 11:127432255-127432277 CAATGTAGTGAGGAGGGCCCAGG + Intergenic
1090776925 11:129973984-129974006 CAGTGCAGAGTGGAGGGGCCAGG + Intronic
1091331899 11:134737031-134737053 CTGTGCCAGGTGGAGGGGCCTGG - Intergenic
1091368920 11:135042749-135042771 CAGTGTGAGCAGGCGGGCCCAGG - Intergenic
1091599438 12:1908935-1908957 CAGTGTCGTGAGGAGGAGCCGGG - Intronic
1092290838 12:7158673-7158695 CAGGTCACGGAGGAGGGGCCGGG - Exonic
1092852947 12:12647494-12647516 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1093560550 12:20533780-20533802 CAGTGTAAGAAAGTGGGGGCCGG - Intronic
1093662632 12:21774806-21774828 CAGTGGAAGGAGGAGGGACTGGG + Exonic
1097987456 12:65799023-65799045 CAGTGCAAGATGGAAGGGCCTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1100830956 12:98516143-98516165 CAGGGTAAGGACGCGGGGCCGGG + Exonic
1101499778 12:105292200-105292222 GAGGGTAGGGAGGAGGGGCTGGG + Intronic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101557609 12:105824908-105824930 CAGTGTTGGGAGGTGGTGCCTGG - Intergenic
1101778620 12:107816067-107816089 CAATGTTGGGAGGTGGGGCCTGG + Intergenic
1102429340 12:112869763-112869785 CAGTGAAGATAGGAGGGGCCCGG + Exonic
1102455025 12:113065771-113065793 GAGGGTGACGAGGAGGGGCCAGG + Intronic
1103289437 12:119832635-119832657 CAGTGTATGGGGGTGGGGACAGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103939789 12:124495487-124495509 CAGTGGATGGAGGAGGGTCCAGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104428825 12:128699842-128699864 GAGTGTCAGCAGGAGGGACCTGG + Intronic
1104466349 12:128993942-128993964 CAGTGTGAGGAGCTGGGGCGAGG - Intergenic
1105347423 13:19586948-19586970 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1105774570 13:23645671-23645693 CAGTGTAAAGAAGAGGACCCAGG - Intronic
1105793359 13:23825155-23825177 CTGTGTATGGTGGTGGGGCCGGG + Intronic
1107479829 13:40776849-40776871 CAAAGTAAGGGGGAGGGGCACGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108147692 13:47497191-47497213 CAGTGCCTGGAGCAGGGGCCAGG - Intergenic
1110941398 13:81354588-81354610 CGGTGTTGGGAGGTGGGGCCTGG + Intergenic
1111961544 13:94816138-94816160 AAGAATTAGGAGGAGGGGCCAGG + Intergenic
1112569728 13:100582789-100582811 CAGTGTCAGGACGAGAAGCCAGG + Intronic
1112963777 13:105161618-105161640 CTGTGGAAGGAGGAGGGCCTGGG + Intergenic
1113433122 13:110267260-110267282 CAGTGGAGGGAGGAGGGGCAGGG + Intronic
1113790891 13:113027596-113027618 GAGTGCACGGAGGAGGGGCTGGG + Intronic
1115653341 14:35419695-35419717 CTGTGCAGGAAGGAGGGGCCAGG + Intergenic
1117406806 14:55411878-55411900 CTGGGCCAGGAGGAGGGGCCTGG + Intergenic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118359990 14:65047826-65047848 AAGTGTAAGGGGGCGGGGCCTGG + Intronic
1119060415 14:71468602-71468624 TAGTGTTAAGAGGTGGGGCCTGG - Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119514783 14:75239611-75239633 GAGTGGAAGGAGGAGAGGGCTGG - Intronic
1120737498 14:88069648-88069670 CAGTGTTGGGAGGCGGAGCCTGG + Intergenic
1121075131 14:91061098-91061120 CCGTGGACAGAGGAGGGGCCTGG + Intronic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122672044 14:103379842-103379864 GAGGGGAAAGAGGAGGGGCCGGG - Intergenic
1123034652 14:105466952-105466974 CACTGACAGGAGGCGGGGCCAGG - Intronic
1123048103 14:105528130-105528152 CCGTGCAGGGAGGAGGGGCGTGG + Intronic
1123683063 15:22776213-22776235 AAGGGAAAGGAGGCGGGGCCAGG + Intronic
1123763091 15:23447336-23447358 AAGGGAAAGGAGGCGGGGCCAGG + Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124334815 15:28848737-28848759 AAGGGAAAGGAGGCGGGGCCAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125741564 15:41968583-41968605 AAGAGTAAAGATGAGGGGCCAGG - Intronic
1127493091 15:59483824-59483846 GAGTCTCAGGAGGAGGGTCCAGG + Intronic
1128346336 15:66854744-66854766 CTGGGGAAGGGGGAGGGGCCAGG + Intergenic
1129113197 15:73350268-73350290 CGGTGCCAGGAGGAGGGGCATGG - Intronic
1129183558 15:73891987-73892009 CAGTCTGAGGACTAGGGGCCAGG + Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129757879 15:78109417-78109439 CAGGATAAGCAGGAGGGCCCCGG + Intronic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130010984 15:80152838-80152860 CAGGGTAGGGGGGAGGGGCAGGG + Exonic
1131122346 15:89830392-89830414 CCGTGTAACGAGGAGGCGCAAGG - Intergenic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1131999427 15:98163872-98163894 CAGTGGAGGGAGGCGTGGCCAGG - Intergenic
1132799479 16:1744573-1744595 CAGTGAGAGGAGGTGGGCCCAGG - Intronic
1133031357 16:3012776-3012798 CAGCGGATGGATGAGGGGCCTGG - Exonic
1133235508 16:4385690-4385712 CAGTGAGAGGAGCAGGGGCTGGG - Intronic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1134263688 16:12674544-12674566 GAGTGAAAGGAGGCGGGGCCTGG + Intronic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1135133983 16:19874305-19874327 CACTGGGAGGAGGAGTGGCCAGG - Intronic
1135736210 16:24933739-24933761 AAGTGTCAGGGGGAGGGGGCTGG + Intronic
1136276379 16:29181470-29181492 CAGTGCTGGGAGGAGAGGCCAGG + Intergenic
1136619447 16:31418369-31418391 CAGTGCAAGCAGGTGGGTCCAGG + Exonic
1137673564 16:50292832-50292854 CAGGGTGAGGAGTGGGGGCCGGG - Intronic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138240668 16:55424689-55424711 CTGTGCATGGAGGAGGGGTCAGG + Intronic
1138530487 16:57631798-57631820 CAGAGACAGGAGGAGGGGCAGGG - Intronic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139630959 16:68231653-68231675 CAGTGTAGGAAGGAGTGGGCCGG + Exonic
1139970355 16:70770377-70770399 CAGTGGATCTAGGAGGGGCCCGG - Intronic
1141884740 16:86883907-86883929 CTGTGTGAGAAGGCGGGGCCTGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142242421 16:88953600-88953622 CAGTGCCAGCAGGAGTGGCCGGG + Intronic
1142442832 16:90111845-90111867 CAGTGTTAGGAGGATTGGTCAGG + Intergenic
1142464869 17:129546-129568 CAGTGTTAGGAGGATTGGTCAGG - Intergenic
1142674329 17:1504308-1504330 CAGTGAGATGAGGAGGGGCCGGG + Intronic
1142717024 17:1752787-1752809 CTGGGTAAGGAGGAGGGTGCGGG + Exonic
1143117607 17:4589532-4589554 GAGTGGGAGGAGGAGAGGCCAGG - Intronic
1145167238 17:20623858-20623880 CAGAGTGAGGAGTAGAGGCCAGG - Intergenic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1146134739 17:30309324-30309346 CTGAGTCAGGATGAGGGGCCAGG + Intergenic
1146193089 17:30787702-30787724 AAGTATGGGGAGGAGGGGCCGGG + Intronic
1147188240 17:38724522-38724544 CAGTGTGATGGGGTGGGGCCTGG + Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147782512 17:42953841-42953863 CAGCCTCAGAAGGAGGGGCCAGG - Intronic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1148289795 17:46434872-46434894 CAGAGTATGGGGGAGGGGCACGG - Intergenic
1148311963 17:46652444-46652466 CAGAGTATGGGGGAGGGGCACGG - Intronic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1150012301 17:61515966-61515988 CAGTAAAAGAAAGAGGGGCCGGG - Intergenic
1151283256 17:73092214-73092236 CAGAGCAAGTGGGAGGGGCCTGG + Intronic
1151497460 17:74467205-74467227 CAGGGTACGGAGGAGGGGGTGGG + Intronic
1151694189 17:75705690-75705712 GGGTGTGAGGAGGAGGGGCCTGG + Intronic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152162029 17:78674846-78674868 TACTGTAATGAGGAGGGGCAGGG + Exonic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1153894179 18:9543880-9543902 TAGTGTGGGGAGGAAGGGCCAGG - Intergenic
1153919047 18:9772284-9772306 CAGCCTAAGGAGGAAGGCCCCGG + Intronic
1154114827 18:11604176-11604198 CGGTGTTGGGAGGTGGGGCCAGG + Intergenic
1155051960 18:22156346-22156368 CTGTATAAAAAGGAGGGGCCGGG + Intergenic
1155735184 18:29212982-29213004 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1156485652 18:37464000-37464022 CGGGGTCAGGAGGAGGGGCCTGG - Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1157291311 18:46411894-46411916 CAGTGAGAGGAGGAAGGGCAGGG + Intronic
1158731162 18:60023961-60023983 CAGAGTAAGTAGGATGGGTCAGG + Intergenic
1158902892 18:61982854-61982876 CAGTGTTGGGAGGTGGGGCCTGG - Intergenic
1159243483 18:65774705-65774727 CAGTGGAAAGATGTGGGGCCTGG + Intronic
1159507389 18:69354772-69354794 GAGAGTAAGGAGGAGTGTCCCGG - Intergenic
1159628886 18:70726459-70726481 CAGTGTTGGGAGGTGGGGCCTGG - Intergenic
1159825478 18:73203613-73203635 CAGTGTGAGGAAGTGAGGCCAGG - Intronic
1160260951 18:77293858-77293880 CAGTGTTGGGAGGAGGGGTCTGG + Intergenic
1160260985 18:77294055-77294077 CAGTGTTGGGAGGTGGGGTCTGG + Intergenic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1163779302 19:19238097-19238119 GAGCCTCAGGAGGAGGGGCCAGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1163843777 19:19627699-19627721 CAGTGTAGGGAGCAGAGACCCGG + Intronic
1163845348 19:19635404-19635426 GAGTGTGAGGAGGTGTGGCCTGG - Exonic
1164103455 19:22080425-22080447 AAGTGTAAGGTGAAGGAGCCAGG - Intronic
1164148982 19:22532577-22532599 CAGAGAAAGGAGGCGAGGCCAGG + Intergenic
1164169189 19:22709366-22709388 CAGGGGAATGAGGAGGGGCTGGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164864565 19:31593140-31593162 CTGTGAGAGGAGGAGAGGCCAGG + Intergenic
1165708603 19:37993712-37993734 AAGTGTGTGAAGGAGGGGCCAGG + Intronic
1166762125 19:45231670-45231692 GAGTGAAAGGTGGAGGGGACAGG + Intronic
1166806857 19:45492797-45492819 CGGTGGATGGGGGAGGGGCCAGG + Intronic
1166916977 19:46202048-46202070 CAGTGTGGGGAGGAGGGGAGAGG + Intergenic
1167611925 19:50511840-50511862 CAGTGGTGGGAGGAGGGGACAGG + Intronic
1167640617 19:50679186-50679208 CAGTGTGACGGGGAGGGGTCAGG + Intronic
1167786717 19:51643605-51643627 CAGGGTGAGGACGAGGGGCCAGG + Exonic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168273686 19:55264962-55264984 AGGTGTGAGGGGGAGGGGCCTGG - Intronic
1168348424 19:55661945-55661967 GAGTGTAGGGAGGAGGGGCAGGG - Intronic
1168669231 19:58228695-58228717 CCGTTTAAGGGGGAGGGGACAGG + Intronic
925038933 2:715186-715208 TAGTGTTTGGAGGTGGGGCCTGG - Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925670947 2:6309317-6309339 GAGTCTGAGGAGGAGTGGCCAGG - Intergenic
925994401 2:9280155-9280177 GGGTGGGAGGAGGAGGGGCCTGG + Intronic
927214003 2:20655986-20656008 CAGTGGGTGGAGGAGGGGACAGG + Intergenic
927611248 2:24543403-24543425 CAGTGTTGGGAGGCAGGGCCTGG - Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
929268522 2:39946230-39946252 CAGTGTAAAGAGGTGGGGTTAGG - Intergenic
929418131 2:41764650-41764672 GAGTCTAAGGAGGAGGCACCAGG + Intergenic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
933071067 2:77858238-77858260 CAATGTTAGGAGGTGGGGTCTGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934729912 2:96649967-96649989 CAGTGTGTGGAGCAGGGTCCAGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934935037 2:98459270-98459292 CAGGGTAGGGAGGAGTGGGCGGG - Intronic
936152002 2:110027149-110027171 CAAGGTAGGGAGGAGTGGCCAGG - Intergenic
936192676 2:110344264-110344286 CAAGGTAGGGAGGAGTGGCCAGG + Intergenic
936816277 2:116464679-116464701 AAGTGGGAGGAGGAGGTGCCAGG + Intergenic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937517425 2:122671051-122671073 TAGTGTTAAGAGGTGGGGCCTGG + Intergenic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
940907690 2:159183787-159183809 GAATGTAAGGAGGAGGGACCGGG + Intronic
941925258 2:170887946-170887968 CATTGTAAAGATGAGGGGACTGG + Intergenic
944582317 2:201142526-201142548 CAGTGAAAGGAGTATGGGCTGGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
946160703 2:217834361-217834383 CAGTGTACTCAGGAGAGGCCTGG - Intronic
946187845 2:217991181-217991203 CAGAGGAGGGAGGAGGGCCCAGG + Intronic
946201654 2:218074020-218074042 CAGTGTGTGGAGCAGGGGACTGG + Intronic
946415303 2:219537203-219537225 CAGTGTCAGAGGGAGCGGCCGGG - Intronic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946784243 2:223225697-223225719 CAGTGGTGGGAGGAGGGGCAGGG + Intergenic
947587550 2:231365928-231365950 CAGTGCCAGTGGGAGGGGCCAGG + Intronic
947752906 2:232541983-232542005 AAGTGTGGGGAGGAGGGCCCGGG + Intronic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
948042579 2:234914988-234915010 GAATGTAAGGAGGAGAGGCATGG + Intergenic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948533145 2:238626322-238626344 CAGTCTCAGATGGAGGGGCCAGG - Intergenic
948640421 2:239372306-239372328 AGGAGTAAGGAGGAGGGCCCGGG - Intronic
948807405 2:240458993-240459015 CAGTGTGAGGGAGAGGGGCTGGG - Intronic
948883829 2:240873332-240873354 CAGTGGGAAGAGGAAGGGCCAGG + Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1170664904 20:18378384-18378406 GAATGGAAGGAAGAGGGGCCTGG - Intergenic
1170889787 20:20367825-20367847 CCGTGAAGGGAGGCGGGGCCGGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171416740 20:24986614-24986636 CAGGGAAAGGAGTAAGGGCCAGG + Intronic
1172093335 20:32448505-32448527 CAGTGGATGGAGGAAGGGGCTGG + Intronic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175224979 20:57439458-57439480 CACTGGCAGGAGGTGGGGCCAGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175713028 20:61236262-61236284 AAGTGTCAGGAGGATGGGCGAGG - Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175851564 20:62096808-62096830 CGGGGGAAAGAGGAGGGGCCAGG + Intergenic
1175857570 20:62130741-62130763 GAGTGTTAGGAGGAGATGCCTGG + Intronic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1177463430 21:21442939-21442961 CAGTGTTTGTAGGAGGGGCGAGG - Intronic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1179179283 21:39031606-39031628 CAGTGGAGGTAGGAGGTGCCGGG - Intergenic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1182283889 22:29232792-29232814 CAGGGCCTGGAGGAGGGGCCGGG - Intronic
1182419699 22:30242967-30242989 CACTGGGAGGAGGAGAGGCCTGG - Exonic
1182746895 22:32612918-32612940 CAATGTTGGGAGGAGGGACCTGG + Intronic
1183350337 22:37331248-37331270 CAGTGGGGGAAGGAGGGGCCTGG - Intergenic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1184391358 22:44205338-44205360 CAGGGAAAGGAGCAAGGGCCTGG - Intronic
1184824159 22:46935830-46935852 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1184824169 22:46935890-46935912 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1184824178 22:46935950-46935972 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1185002401 22:48253854-48253876 CAGTGTAAGGAGGGAGGGCGAGG - Intergenic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
950187185 3:10952390-10952412 CAGAGGAAGGAGGGGGGTCCAGG + Intergenic
950851585 3:16067277-16067299 CAGTGTTGGGAGGTGGGGCCTGG + Intergenic
952258378 3:31714850-31714872 CAGTGTTAAGAGGAGGCGTCTGG - Intronic
952828808 3:37545892-37545914 AAGTGTAAGGAGCAGGTTCCAGG - Intronic
952864882 3:37848323-37848345 CTGTGTAAGAAGGAGAAGCCAGG + Intergenic
953336405 3:42098087-42098109 CAGGGTGAGGAGGAGGGGAGGGG - Intronic
956645071 3:71447281-71447303 ATGTGTAAGGCAGAGGGGCCTGG - Intronic
958605458 3:96352842-96352864 CAGTGTTGGGGGGAGGGACCTGG + Intergenic
960628310 3:119702919-119702941 AAGTGAAAGCAGGAGTGGCCAGG - Intergenic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
962500013 3:135981763-135981785 GAGAGTAATGAGAAGGGGCCAGG + Intronic
963852956 3:150226074-150226096 TCGAGTAAGGTGGAGGGGCCGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966866573 3:184261622-184261644 CAGGGGAAAGAGGCGGGGCCGGG + Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
967976025 3:195035313-195035335 CCGTGGATGGAGGAGGGCCCAGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968363104 3:198162805-198162827 CAGTGTTAGGAGGATCGGTCAGG + Intergenic
968446125 4:653234-653256 GAGTGTGAGGAGGCAGGGCCTGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
969016842 4:4108819-4108841 CAGTGGAAGCAGGAGAGGCTGGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972391433 4:38617330-38617352 CAGTGTTTGGAGGTGGGGCCTGG + Intergenic
973167101 4:47091686-47091708 CAGTGTATGCAGGTGGGTCCAGG - Intronic
973601276 4:52545250-52545272 CAGACTCAGGAGGAGGGGCTGGG - Intergenic
974000728 4:56508217-56508239 CAAGGTAAGGAAGAGGGGCAAGG - Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
974220774 4:58968290-58968312 CAGTGTAGGATGGAGGGGCTTGG + Intergenic
974581957 4:63814779-63814801 CCCTGTAAGCAGGAGTGGCCAGG + Intergenic
977433061 4:96956929-96956951 AAGTGTAAGGTGGAGGTGCTAGG - Intergenic
977807557 4:101320541-101320563 CAGTGGAGGGCGGAGGGGCTTGG + Intronic
978524186 4:109647874-109647896 CAGTGTAAGGAAGAGGTGCTGGG + Intronic
985616096 5:922911-922933 CAGTGGGAGGCGGAGGGGCCAGG - Intergenic
985672783 5:1214800-1214822 CAGTGCAAGGGGGCAGGGCCTGG + Intronic
985705747 5:1400527-1400549 CAGTGCCAGGAGGGGAGGCCTGG - Intronic
985815597 5:2125652-2125674 GAGTGTTGGGAGGAGGGCCCAGG + Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986290076 5:6392783-6392805 TTGTGGATGGAGGAGGGGCCGGG - Intergenic
986393665 5:7306747-7306769 AAGGGAAAGGAGGCGGGGCCAGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987122933 5:14784635-14784657 CAGAGTAAGGAGCAGGGTCATGG + Intronic
990251902 5:53924683-53924705 CAGAGTTGGGAGGAGGGGCATGG - Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992799148 5:80280307-80280329 AAGTGTAAGGAGGAGGGACTGGG - Intergenic
993042998 5:82836585-82836607 AAGTGAGAGGAGGAGGTGCCAGG + Intergenic
996783679 5:127215511-127215533 TAGTGTTGGGAGGTGGGGCCTGG + Intergenic
997437455 5:133885530-133885552 CATTGTGAGGAGGAGGAGCTGGG + Intergenic
998400247 5:141844938-141844960 CAGTGGCAGGAGGAGGGGATTGG + Intergenic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
999242137 5:150133842-150133864 CAGGGGTCGGAGGAGGGGCCAGG - Intronic
999321494 5:150618264-150618286 CTGTGTAAGGAGCAGAGACCAGG + Exonic
999325167 5:150639305-150639327 CAGGGGAAGGAGGCTGGGCCTGG - Intronic
999335078 5:150708325-150708347 CAGTGTTAAGAGGTGGGGCTGGG + Intergenic
999386181 5:151156008-151156030 GAGTGTGCAGAGGAGGGGCCAGG - Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001299930 5:170526123-170526145 AAGTGCAAGGTGGAGGAGCCAGG - Intronic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1001959385 5:175871276-175871298 CAGTGTAAGGTGGAGGAGAGAGG + Intronic
1002445960 5:179290121-179290143 CAGTGTTGGAAGGTGGGGCCTGG + Intronic
1002535666 5:179874154-179874176 GAGTGTAGCCAGGAGGGGCCGGG + Intronic
1003071283 6:2947390-2947412 CAGGTAAAGGAGGAGAGGCCAGG + Intergenic
1003333730 6:5151419-5151441 CAGTGAAAGGGAGATGGGCCAGG - Intronic
1003468837 6:6409547-6409569 CAGTGCAAAGGGGAGGGGCCAGG - Intergenic
1003660451 6:8055916-8055938 CAGTGTTGGGAGGTGGGGTCTGG + Intronic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004523546 6:16384590-16384612 CAGTGTTTGGAGGAAGGGCCTGG + Intronic
1004935214 6:20500835-20500857 CAGTGTCAAGAGGCGGGGCGTGG + Intergenic
1005916631 6:30357838-30357860 CAGAGGAAGGCGGAGGGGCGAGG - Intergenic
1006423665 6:33950677-33950699 CAGGGCCAGGAGGAGGGGCTGGG + Intergenic
1006942862 6:37764613-37764635 CAGTGTGAGGTAGAGGGGCTGGG - Intergenic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008019343 6:46558510-46558532 CATTTGGAGGAGGAGGGGCCTGG - Intronic
1008921545 6:56848553-56848575 CAGTGTGAGGATGAGGGTACAGG - Intronic
1009553121 6:65125762-65125784 TATTGTTAGGAGGTGGGGCCAGG - Intronic
1009966811 6:70586863-70586885 CAGTTTAAGAATTAGGGGCCAGG + Intronic
1011771892 6:90682623-90682645 CATTGTTAGTAGGAGGAGCCTGG + Intergenic
1014098042 6:117481828-117481850 TAGTGTACAGAGTAGGGGCCAGG - Intronic
1015054142 6:128878913-128878935 CAGTGTTTGGAGGTGGGGACAGG + Intergenic
1016068080 6:139704571-139704593 CAGTGTTGGGAGGTGGGGCCTGG + Intergenic
1018759829 6:166884310-166884332 CAGGGTATGGAGGAAGGGGCAGG - Intronic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019196583 6:170286767-170286789 GTGTGTGAGGAGGTGGGGCCGGG - Intronic
1019252577 7:25907-25929 CAGTGTTAGGAGGATTGGTCAGG - Intergenic
1019333665 7:472466-472488 AAGTGTCAGGATGAGGGGGCCGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019423360 7:962129-962151 CACTGTGGGGAGGAGGGGTCAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020201182 7:6081398-6081420 AAGTGGAAGGCGGCGGGGCCGGG - Intergenic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023706027 7:42942633-42942655 CAGTGTAAGGAGAATGTGCTGGG + Intronic
1024397063 7:48881904-48881926 CAGTGTTGGGAGTTGGGGCCTGG - Intergenic
1024570514 7:50719246-50719268 GACTGCAAGGAGGAAGGGCCAGG + Intronic
1025190411 7:56891682-56891704 CAGTGTAATGAGTACGGGCACGG + Intergenic
1025222250 7:57123229-57123251 GAGTGTGAGGTGGAGGAGCCAGG + Intronic
1025251390 7:57353645-57353667 CAGGGTAGGTAGGTGGGGCCTGG + Intergenic
1025266740 7:57466511-57466533 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1025633033 7:63294910-63294932 GAGTGTGAGGTGGAGGAGCCAGG + Intergenic
1025681528 7:63685238-63685260 CAGTGTAATGAGTACGGGCACGG - Intergenic
1025743119 7:64217206-64217228 GAGTGTGAGGTGGAGGAGCCAGG - Intronic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1026463745 7:70636173-70636195 CTGTGTCACGAGGAGTGGCCCGG + Intronic
1026647932 7:72188898-72188920 CGGTGTAGGGAGTTGGGGCCTGG - Intronic
1026942228 7:74293773-74293795 CAGTGTGGGGAGGAGAGGACAGG + Intronic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1027516104 7:79144307-79144329 CAGTGGTTGGAAGAGGGGCCTGG + Intronic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1033648631 7:143323399-143323421 CAGTGAAATGAGCTGGGGCCAGG + Intronic
1033662286 7:143410281-143410303 GAGCGAAAGAAGGAGGGGCCAGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034497192 7:151430192-151430214 AGGTGAAAGGAGGTGGGGCCAGG + Intronic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035551784 8:533583-533605 CTGTTTAAGGAGGAGGGGTTGGG - Intronic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1036379656 8:8228468-8228490 CAGGGTCAGGAGGAGCGTCCTGG - Intergenic
1036611420 8:10353394-10353416 GCGTGTACGGAGGAGGGACCTGG + Intronic
1037082147 8:14800514-14800536 CAGGTTTTGGAGGAGGGGCCTGG + Intronic
1037503385 8:19506581-19506603 CAGTGTTGGGAGGTGGGGCCTGG + Intronic
1037560980 8:20074116-20074138 CAGAGTCAGGAGGTGGGGCGTGG + Intergenic
1038213928 8:25544324-25544346 CAGTCTTGGGAGGTGGGGCCTGG - Intergenic
1038395828 8:27244736-27244758 AAGTGGAAAGAGGAGGGGGCGGG + Intronic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1040393300 8:46968751-46968773 GAGGGAAAGGAGGAGGTGCCAGG - Intergenic
1040596034 8:48838671-48838693 CAATGCAAGGAGGAAGTGCCTGG - Intergenic
1040877263 8:52166595-52166617 CAGTGTCCAGAGGAAGGGCCAGG - Intronic
1042811191 8:72827034-72827056 CAGTGTATTGAAGAGGGTCCTGG + Intronic
1043738283 8:83774979-83775001 CACTACAAGCAGGAGGGGCCAGG - Intergenic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1043951898 8:86318694-86318716 AAGTGTTATGAGGAGGGGCCTGG + Intronic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1047023961 8:120807433-120807455 CATTTTAAGGAGTAGGGGCAGGG - Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047357904 8:124140760-124140782 CACAGGAAGGAGGAAGGGCCAGG + Intergenic
1048802915 8:138210688-138210710 CAATGTTAGGGGGAGGGACCTGG - Intronic
1049110564 8:140639860-140639882 CAGGATAGGGTGGAGGGGCCTGG + Intergenic
1049296385 8:141842476-141842498 GAGTGTAAGGGGGAAGGGCTGGG - Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049676470 8:143891476-143891498 CAGTGGCTGGAGGAGGGGCCCGG - Intergenic
1049750317 8:144280006-144280028 CAGTGTCATGCTGAGGGGCCGGG - Intronic
1050351699 9:4746018-4746040 CAGTTAAAGGTGGAGGGGACAGG - Intergenic
1051626253 9:19102505-19102527 GAGTGTAAGGAGGCCGGGGCCGG - Exonic
1051731318 9:20146212-20146234 GAATGTAAGGTGGAGGGGCAAGG + Intergenic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1052210968 9:25902832-25902854 CAGTGTCAGGAGGATTGGCATGG - Intergenic
1053042741 9:34888758-34888780 CAGTATAAGAAGCAGTGGCCAGG - Intergenic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1054443172 9:65284702-65284724 GGGTGCGAGGAGGAGGGGCCTGG - Exonic
1054487108 9:65736799-65736821 GGGTGCGAGGAGGAGGGGCCTGG + Exonic
1055337578 9:75248109-75248131 CAGTGTTGGAGGGAGGGGCCTGG + Intergenic
1056401614 9:86233026-86233048 AAGAGTTATGAGGAGGGGCCGGG - Intronic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1057600209 9:96450695-96450717 CGGTTTCAGGAGGAGGGGCCCGG + Intronic
1058444266 9:105040629-105040651 CAGTGTTGGGAGGTGGGGCTAGG - Intergenic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060153953 9:121306076-121306098 GAGTGGGAGGAGGAGGGGCGGGG - Intronic
1060263025 9:122092676-122092698 AAGTGGAAGGAGGTGAGGCCCGG - Exonic
1060945400 9:127567337-127567359 CTGTGGGAGGAGGAAGGGCCAGG - Intronic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061967567 9:134025020-134025042 CTGGGAAAGGAGGAGGGGCTGGG - Intergenic
1062057341 9:134475394-134475416 CCGGGGAAGGAGGAGGGACCCGG + Intergenic
1062582066 9:137233166-137233188 CAGGGTCAGGTGGGGGGGCCCGG - Intronic
1062747791 9:138226467-138226489 CAGTGTTAGGAGGATTGGTCAGG + Intergenic
1185445326 X:254869-254891 CAGGGTCAGGAGGAACGGCCAGG + Intergenic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187534959 X:20133069-20133091 CCCTGTAAGTAGGAGGGGCACGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1189314008 X:40040901-40040923 AAGGAGAAGGAGGAGGGGCCAGG - Intergenic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1190855379 X:54289241-54289263 CAGTGTAAAGAGGATGCTCCAGG + Intronic
1192141067 X:68647611-68647633 CCGGCTAAGGAGGAGGGACCAGG - Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1194617551 X:96124871-96124893 CAGTGTAAGCACCAGAGGCCTGG - Intergenic
1195353585 X:104017117-104017139 CGGTGTAAGGAAGGGGGTCCAGG + Intergenic
1195708200 X:107753240-107753262 CAGGGAAGGGAGGAAGGGCCAGG + Intronic
1195877893 X:109561456-109561478 ATGTGTTAGGAGGTGGGGCCTGG + Intergenic
1196469312 X:116007847-116007869 CAGGGTTAGGAGGATGGGCTGGG + Intergenic
1197773428 X:130105318-130105340 CAGGGTGAGGAGGAGGGTCAGGG - Intronic
1198549283 X:137727563-137727585 CATTGGAAGCAAGAGGGGCCAGG + Intergenic
1199764858 X:150934099-150934121 CAGTGTAAGTCTGAAGGGCCAGG - Intergenic
1199969415 X:152848157-152848179 CAGTGTTAAGAATAGGGGCCAGG - Intronic
1200162396 X:154016277-154016299 CAGGGTGAGGAGGAGGGCCTCGG + Intronic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic