ID: 1148361150

View in Genome Browser
Species Human (GRCh38)
Location 17:47013511-47013533
Sequence AACCCTTTCCTGCTACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148361149_1148361150 -8 Left 1148361149 17:47013496-47013518 CCAGACTGATCTCATAACCCTTT 0: 1
1: 0
2: 1
3: 12
4: 205
Right 1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG 0: 1
1: 1
2: 0
3: 17
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148361150 Original CRISPR AACCCTTTCCTGCTACAGCC TGG Intronic
900292269 1:1928558-1928580 CACCCTTCCCTGCTCCCGCCTGG + Intronic
900365151 1:2308980-2309002 CACCCTTTCCTGCAGCTGCCAGG + Exonic
902343996 1:15802523-15802545 AGCCCTTTCCTTCTACAACTCGG + Intergenic
903257475 1:22112635-22112657 AGCCCCTTCCTGCTGCAGGCAGG + Intergenic
903599546 1:24525785-24525807 ATCCCTTTCGTGCTAATGCCGGG + Intronic
903891799 1:26574737-26574759 AACCACTTCCTGCTACAGGAGGG + Intronic
904711770 1:32435372-32435394 ATCACTTGCCTGCTACAGCATGG + Intergenic
904894587 1:33804894-33804916 AACCCTATCCTGATCCAGGCGGG - Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905350617 1:37343910-37343932 AACCATTTCCTTCTACAGAGGGG - Intergenic
906120070 1:43383649-43383671 AGTCCTTTGCTGCCACAGCCTGG + Intergenic
907386545 1:54129250-54129272 AACCATTTCCTGATCCATCCAGG + Intergenic
907521403 1:55025628-55025650 ATCACTTGCCTGCTACAGCATGG + Intergenic
908591812 1:65644555-65644577 ATCACTTGCCTGCTACAGCATGG - Intergenic
909035609 1:70591329-70591351 ATCACTTTCCTGTTACAGCATGG + Intergenic
909223519 1:72990492-72990514 ATCACTCGCCTGCTACAGCCTGG - Intergenic
909788130 1:79641407-79641429 ATCACTTGCCTGCTACAGCATGG - Intergenic
911166891 1:94732257-94732279 CATCCTTCCCTGCTTCAGCCAGG - Intergenic
911235778 1:95410790-95410812 AGCCCTTTCCTTCTACAACTGGG - Intergenic
912480574 1:109979423-109979445 AATCCTTTCCTGCAGCAGACGGG + Intergenic
913335771 1:117708111-117708133 AACCCTTCAGTGCTAAAGCCAGG - Intergenic
915220654 1:154371887-154371909 AGCCCTTTCCTTCTACAACTCGG + Intergenic
916634412 1:166653032-166653054 AGCCCTTTCCTTCTACAACTCGG - Intergenic
917391990 1:174547232-174547254 AGCCTTTTCCTGCTACCACCTGG + Intronic
918099510 1:181361406-181361428 AGACCTTCCCTGCTACATCCAGG - Intergenic
918966641 1:191358592-191358614 AACATTTTCCTTCTACAGCCTGG + Intergenic
920387574 1:205579733-205579755 CACCCTTCCCTCCTGCAGCCTGG + Exonic
921287629 1:213623103-213623125 ATCGCCTTCCTTCTACAGCCAGG - Intergenic
921900097 1:220441005-220441027 ATCCCTTTCCTGCTCCCTCCTGG - Intergenic
922068318 1:222166165-222166187 AAAGCTTTCATGCTAAAGCCAGG + Intergenic
923244895 1:232121212-232121234 ATCGCTTGCCTGCTACAGCATGG + Intergenic
923257201 1:232232312-232232334 ATCGCTTGCCTGCTACAGCATGG - Intergenic
923471403 1:234294196-234294218 TACCCTTTCCTGCAACACCCAGG + Intronic
924046482 1:240037330-240037352 AACCCTTTCCTTCTACAACTTGG - Intronic
924357520 1:243197604-243197626 TACCCCTTCCTGCTACTGGCAGG + Intronic
1068058207 10:52036446-52036468 ATCACTTGCCTGCTACAGCATGG - Intronic
1068179514 10:53501713-53501735 ATCACTTGCCTGCTACAGCATGG - Intergenic
1068231114 10:54169785-54169807 ATCACTTGCCTGCTACAGCATGG + Intronic
1069622969 10:69849261-69849283 ATCCCTTTCCTGCTTCCTCCAGG + Intronic
1069962247 10:72086088-72086110 GACCCTGTCCTCCTGCAGCCAGG + Intronic
1070214586 10:74363642-74363664 CAGCCTTTCCTGCTGCAACCAGG - Intronic
1071916340 10:90298027-90298049 AACACTCGCCTGCTACAGCATGG + Intergenic
1073709348 10:106020294-106020316 ATCACTTGCCTGCTACAGCATGG - Intergenic
1076993398 11:287382-287404 AACCCCTTCCTGCACCTGCCTGG - Intergenic
1076993514 11:287870-287892 AACCCCCTCCTGCAACTGCCTGG - Intergenic
1077466936 11:2737966-2737988 ATCCATTTCCTGCTCCAGGCAGG + Intronic
1078452148 11:11448620-11448642 GTCCCTTTCCTGCTTCAGCCAGG - Intronic
1078904557 11:15671786-15671808 AACACTTCTCTGGTACAGCCAGG - Intergenic
1078937717 11:15966217-15966239 AAGTATTTCCTGCTGCAGCCAGG + Intergenic
1079847551 11:25489901-25489923 ATCACTTGCCTGCTACAGCATGG - Intergenic
1081146978 11:39573604-39573626 AACTCTTGCCTTCTGCAGCCAGG + Intergenic
1081752462 11:45521569-45521591 AAACCTTCCTTGCTTCAGCCAGG - Intergenic
1081849567 11:46265667-46265689 AACCCTTTCCTGGTTGGGCCCGG + Intergenic
1083530614 11:63418404-63418426 AGCCCTTTTCTGCAACAGCCTGG + Intergenic
1084564728 11:69922362-69922384 AACCCCTGCCTGCTGCAGCCTGG - Intergenic
1085988150 11:81809241-81809263 ATCACTTGCCTGCTACAGCATGG + Intergenic
1086136126 11:83445580-83445602 ATCACTTGCCTGCTACAGCATGG - Intergenic
1087099774 11:94352678-94352700 ATCACTTGCCTGCTACAGCATGG + Intergenic
1088921840 11:114265050-114265072 AACCCTACCCTGCAACATCCAGG - Intronic
1091814015 12:3422412-3422434 AGCCCTTTCCTTCTACAACTTGG - Intronic
1091814876 12:3430012-3430034 AGCCCTTTCCTTCTACAACTTGG - Intronic
1092416052 12:8291267-8291289 ATCACTTACCTGCTACAGCATGG - Intergenic
1092592619 12:9965752-9965774 ATCACTCTCCTGCTACAGCATGG - Intronic
1093488794 12:19681598-19681620 AACCCTTTCCTTTCACAGCTGGG - Intronic
1093764605 12:22948505-22948527 AACCCTTTCCTTCCATAGCAGGG - Intergenic
1097029091 12:56079260-56079282 TCCCCTTTCCTGCGAGAGCCTGG + Intergenic
1097693747 12:62757928-62757950 AACCCTTTATGGCTCCAGCCTGG + Intronic
1101883777 12:108644033-108644055 ACGCCTTTCCTGCTTCAGACGGG - Intergenic
1102342360 12:112133200-112133222 AACCCTTTCCTCCACCAGTCTGG - Intronic
1103770967 12:123323783-123323805 AACATTTTCCTGCTCCAGACAGG - Exonic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1109709521 13:66144012-66144034 ATCACTTGCCTGCTACAGCATGG - Intergenic
1112692745 13:101916092-101916114 CACCCCTTCCTGCCACACCCGGG - Intronic
1113063399 13:106349467-106349489 AACCCTTTCCAGGTAGCGCCTGG - Intergenic
1113732340 13:112650348-112650370 AACCCTTTCCTTTTATAGCTGGG - Intronic
1113788394 13:113014927-113014949 GACCCTTCCCAGCTCCAGCCTGG - Intronic
1113883854 13:113647131-113647153 AGCCCCTTCCTGATAAAGCCGGG - Intergenic
1114248465 14:20936101-20936123 AACCCTTTCCTGGAACTCCCAGG - Intergenic
1115372300 14:32630718-32630740 AACCCTTTCCTGATACAAAGGGG + Intronic
1116039104 14:39664039-39664061 AACCCTTGGCTCCTCCAGCCGGG - Intergenic
1116057025 14:39876500-39876522 AAGCCCTTCCTTCTACAGCTTGG - Intergenic
1116534637 14:46015104-46015126 ATCACTTGCCTGCTACAGCATGG - Intergenic
1116702265 14:48258061-48258083 ATCACTTGCCTGCTACAGCATGG - Intergenic
1117801325 14:59447109-59447131 ATCACTTGCCTGCTACAGCATGG + Intronic
1118723523 14:68610341-68610363 AACCCTTTCCTTCTCCTCCCTGG + Intronic
1120251259 14:82063765-82063787 ATCACTTGCCTGCTACAGCATGG - Intergenic
1120712210 14:87804647-87804669 AGCCCTTTCCTTCTACAGTTCGG + Intergenic
1122041137 14:98988229-98988251 ATCACTTGCCTGCTACAGCATGG + Intergenic
1124397129 15:29312129-29312151 TAACTTTTCCTGCTACAGTCTGG + Intronic
1125507592 15:40276011-40276033 CACCCCTTCCTGCTGCAGACAGG + Exonic
1126843889 15:52741611-52741633 ATCACTTGCCTGCTACAGCATGG + Intergenic
1132263156 15:100443321-100443343 ATCACTCTCCTGCTACAGCATGG + Intronic
1132340557 15:101075570-101075592 ATCACTCTCCTGCTACAGCATGG + Intronic
1132372756 15:101309601-101309623 GACGCTTTCATGCTCCAGCCTGG + Intronic
1132505596 16:306955-306977 CACCCTTTCCCGCTGCACCCGGG + Intronic
1135226192 16:20660391-20660413 TACCCTCTCCTGATACAGACAGG + Intronic
1136351021 16:29707909-29707931 AAGCCTTTCCTTCTACAACTTGG + Intergenic
1138758958 16:59520317-59520339 ATCCCTCGCCTGCTACAGCATGG - Intergenic
1139039098 16:62981825-62981847 ATCACTCTCCTGCTACAGCATGG - Intergenic
1139225774 16:65232510-65232532 ATCACTCTCCTGCTACAGCATGG - Intergenic
1139453346 16:67049969-67049991 ATCTGTTTCCTGGTACAGCCAGG + Intronic
1140236493 16:73164007-73164029 AAGGCTTTCCACCTACAGCCAGG - Intergenic
1142499171 17:322757-322779 AACCGTTAGCTGCAACAGCCGGG - Intronic
1146815710 17:35940342-35940364 AACCCTTTCCTGCTCCAGCCTGG - Intronic
1147214979 17:38893773-38893795 AACCCGTCACTGCTCCAGCCTGG - Intronic
1147771240 17:42868862-42868884 ATGCCTTACCTGCTACATCCAGG - Intergenic
1147836751 17:43338314-43338336 AACCCTATCCCTCCACAGCCTGG - Intergenic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG + Intronic
1150529103 17:65958682-65958704 AACCCTTGACACCTACAGCCTGG + Intronic
1151380146 17:73720118-73720140 TACCCTTTCCTGCTGCCACCTGG - Intergenic
1155083206 18:22430621-22430643 CCCCCTCTCCTGCCACAGCCTGG + Intergenic
1156124250 18:33883793-33883815 AACCCTGTCATACTACAGCATGG + Intronic
1156502989 18:37571372-37571394 AACCATTCCCTGCCAGAGCCAGG - Intergenic
1156596831 18:38557211-38557233 AACCCTTTCCTGCCCCTTCCAGG + Intergenic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1157906254 18:51572713-51572735 ATCACTTGCCTGCTACAGCATGG - Intergenic
1158292586 18:55957921-55957943 AGCCCTTTCCTTCTACAACTCGG + Intergenic
1161712255 19:5855450-5855472 ATCCCTCGCCTGCTACAGCATGG + Intergenic
1165148474 19:33747633-33747655 AGCCCTCTCCTGCTCCTGCCGGG - Intronic
1166927001 19:46276006-46276028 ATCACTCTCCTGCTACAGCATGG - Intergenic
1167099598 19:47396073-47396095 ATCACTCTCCTGCTACAGCATGG + Intergenic
924993202 2:333246-333268 AAGGCTTTCCTCCTACAGTCAGG + Intergenic
926407903 2:12572786-12572808 ATCACTTGCCTGCTACAGCATGG + Intergenic
927493259 2:23534631-23534653 GCCCCTTTCCTGCCACAGCAGGG + Intronic
928137660 2:28700276-28700298 AACCCTCTTCTGCTTCAGCCAGG + Intergenic
928770933 2:34701375-34701397 ATCACTCTCCTGCTACAGCATGG + Intergenic
929076539 2:38083445-38083467 ATCACTTGCCTGCTACAGCATGG - Intronic
930098935 2:47588344-47588366 ATCACTTGCCTGCTACAGCATGG - Intergenic
932358678 2:71087722-71087744 ATCACTTGCCTGCTACAGCTTGG - Intergenic
932761017 2:74439465-74439487 TGCCCATTCCTGCTACAGCATGG - Intronic
932800789 2:74740797-74740819 ACCCCTCTGCTGCCACAGCCTGG - Intergenic
933195468 2:79384317-79384339 AATGCTTTCCTTGTACAGCCTGG - Intronic
933767159 2:85717976-85717998 AGCCCTTTCCTCCTAGAGCATGG - Intergenic
934120753 2:88836884-88836906 AACCCATTCATGTTACAGACAGG + Intergenic
934903206 2:98177156-98177178 AAACCATCCCTGCTATAGCCAGG - Intronic
935611945 2:105035173-105035195 AGCCCTTTCCTTCTACAACTCGG - Intergenic
936061063 2:109296059-109296081 ATCCCTTCCCTGCCCCAGCCAGG + Intronic
936632722 2:114221285-114221307 AACCTTTTCCTTGTACAGTCTGG - Intergenic
940107484 2:150115636-150115658 ATCACTTGCCTGCTACAGCATGG + Intergenic
940530319 2:154870346-154870368 ATCACTTGCCTGCTACAGCATGG + Intergenic
942276936 2:174329819-174329841 AACTCTTTCCTCCTCCATCCAGG - Intergenic
943421443 2:187673163-187673185 ATCACTTGCCTGCTACAGCATGG - Intergenic
944477768 2:200124945-200124967 AGCCCTTTCCTTCTACAACTTGG - Intergenic
945376243 2:209081103-209081125 ATCACTTGCCTGCTACAGCATGG + Intergenic
946886633 2:224228321-224228343 ATCACTTGCCTGCTACAGCATGG + Intergenic
947603865 2:231471089-231471111 AACCCCTTCCTGCTGCAGAGAGG + Intronic
948390830 2:237609981-237610003 ATCACTTGCCTGCTACAGCATGG + Intergenic
948612750 2:239180179-239180201 CACCCTCTCCTGCGAGAGCCTGG + Intronic
1168938059 20:1685152-1685174 AGACCTTTCCTGGTGCAGCCTGG - Intergenic
1168943137 20:1730423-1730445 ATCACTTTCCTGTTACAGCATGG - Intergenic
1169736412 20:8842557-8842579 AGCCCTTTCCTTCTACAACTCGG - Intronic
1170029976 20:11934478-11934500 TACCCTCTCCTGCTACATTCAGG + Intergenic
1170575937 20:17661531-17661553 TACACCTTCCTGCCACAGCCCGG + Intronic
1173652186 20:44673389-44673411 ATCACTTGCCTGCTACAGCATGG + Intergenic
1178447550 21:32659766-32659788 AGCCCTTTCCTTCTACAACTCGG + Intronic
1178448214 21:32664699-32664721 AGCCCTTTCCTTCTACAACTTGG + Intronic
1182512028 22:30826556-30826578 AACCCAGTCCTGCTACAGAAGGG - Intronic
1183487895 22:38099224-38099246 AAGCCTTTCCTGTTACAGATGGG - Intronic
949190251 3:1242486-1242508 ATCACTTGCCTGCTACAGCATGG - Intronic
950926633 3:16747347-16747369 ATCACTTGCCTGCTACAGCATGG + Intergenic
953308038 3:41848545-41848567 ACACCTTTCCTCCTACAGTCTGG + Intronic
955559438 3:60172781-60172803 ACCTCTTTCCTGCAACAGCCTGG - Intronic
957406712 3:79780920-79780942 AGCCCTTTCCTTCTACAACTTGG + Intergenic
959313224 3:104768293-104768315 AAGCCTTTTCAGCAACAGCCAGG + Intergenic
961678096 3:128580310-128580332 AACTCTCTCCAGCTACACCCTGG + Intergenic
961711486 3:128831873-128831895 ATCACTTGCCTGCTACAGCATGG - Intergenic
963058765 3:141208000-141208022 ATCACTTGCCTGCTACAGCATGG + Intergenic
963111703 3:141693975-141693997 ATCACTTGCCTGCTACAGCATGG - Intergenic
964705601 3:159615584-159615606 GACCCTTACCTGCCTCAGCCAGG + Intronic
965335238 3:167425626-167425648 ATCACTTGCCTGCTACAGCATGG + Intergenic
966221297 3:177553783-177553805 AACCCTTCCCTGGCAGAGCCTGG - Intergenic
967244042 3:187468951-187468973 ATCACTTGCCTGCTACAGCATGG - Intergenic
968295834 3:197575906-197575928 ACCCCTTTCCTGTAACAGCATGG - Intergenic
970437341 4:16048350-16048372 AACCATTTTCTGCTACAACAGGG + Intronic
974314163 4:60255975-60255997 AGCCCTTTCCTTCTACAGCTCGG + Intergenic
976553883 4:86428182-86428204 ACCACTTTGCTGCTCCAGCCTGG - Intronic
977010453 4:91627111-91627133 ATCACTCTCCTGCTACAGCATGG + Intergenic
977062366 4:92274181-92274203 AACACTCGCCTGCTACAGCATGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
979244289 4:118481876-118481898 TACCCCTTCCTGCTACTGGCAGG - Intergenic
981696307 4:147562748-147562770 AACCCTTTCCTGCCACTTTCAGG - Intergenic
981802318 4:148672715-148672737 CAACATTTCCTCCTACAGCCTGG + Intergenic
982180343 4:152744012-152744034 ATCACTTGCCTGCTACAGCATGG - Intronic
982331562 4:154186966-154186988 ACCCCTTTCCTGCAACAACAGGG + Intergenic
983281872 4:165691043-165691065 AACCCTTTACTTCTCCAGACAGG + Intergenic
983432736 4:167671903-167671925 AACCATTGCCTGGTAGAGCCTGG - Intergenic
983448187 4:167879283-167879305 ATCACTTGCCTGCTACAGCATGG + Intergenic
983837901 4:172415628-172415650 AGCCCTTTCCTTCCACAGCTTGG - Intronic
984707512 4:182858428-182858450 AACCCTTACCTGGCACGGCCAGG - Intergenic
986389017 5:7266615-7266637 ATCACTTGCCTGCTACAGCATGG + Intergenic
986465742 5:8021164-8021186 AACCCCCTCCTGTTACAGGCAGG - Intergenic
986566658 5:9122717-9122739 AACCCGCTCCTGCGACAGCCCGG - Exonic
986821078 5:11467327-11467349 AACCCATTCCAGATACAACCAGG - Intronic
988276938 5:29092433-29092455 AGCCCTTTCCTTCTACAACTCGG + Intergenic
988938292 5:36113427-36113449 AGCCCTTTCCTTCTACAACTCGG + Intronic
989775882 5:45206542-45206564 AAGCCCTTCCTTCTACAGCTCGG + Intergenic
992614061 5:78532968-78532990 AACCCTGTCGTGCTGCAGACTGG + Intronic
993836830 5:92826990-92827012 ATCACTCTCCTGCTACAGCATGG + Intergenic
994853568 5:105088077-105088099 AAGTCCTTCCTGCTAAAGCCTGG - Intergenic
995237960 5:109851735-109851757 ACCCCTTTCCTGCTACTGGTTGG + Intronic
996745300 5:126842235-126842257 ATCACTTGCCTGCTACAGCATGG - Intergenic
997770497 5:136549009-136549031 ATCACTTGCCTGCTACAGCATGG - Intergenic
997772512 5:136568030-136568052 ATCACTTGCCTGCTACAGCATGG - Intergenic
998693567 5:144614033-144614055 ATCACTTGCCTGCTACAGCATGG - Intergenic
999229824 5:150055178-150055200 ATCCCTTTCCAGCGAAAGCCTGG + Intronic
1000107189 5:158071279-158071301 AACCCCTTCCTGTTGGAGCCTGG + Intergenic
1000107313 5:158072500-158072522 AGTCATTTGCTGCTACAGCCAGG - Intergenic
1000607075 5:163337051-163337073 ATCACTTGCCTGCTACAGCATGG + Intergenic
1001354163 5:171004072-171004094 ATCACTTGCCTGCTACAGCATGG - Intronic
1001535121 5:172492659-172492681 CACCCTTTCCTTCCACAGGCTGG - Intergenic
1003896784 6:10615558-10615580 ATCCCTTTCCTGTAACAGGCAGG - Intronic
1005717662 6:28566983-28567005 AAGCCTTTCCTTCTACAACTCGG - Intergenic
1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG + Intronic
1009964910 6:70567433-70567455 AATCCTTTTCTGCTGGAGCCTGG - Intronic
1010586556 6:77663234-77663256 ATCACTTGCCTGCTACAGCATGG - Intergenic
1012315959 6:97782612-97782634 ATCACTTGCCTGCTACAGCATGG + Intergenic
1013407752 6:109858444-109858466 ATCACTTGCCTGCTACAGCATGG - Intergenic
1013559481 6:111290182-111290204 AAGCCCTTCCTTCTACAACCTGG - Intergenic
1013989059 6:116232024-116232046 AAACCAATCCTGCTACAACCTGG - Intronic
1014336777 6:120147229-120147251 AACCCTTTCCTTTCACAGCTGGG + Intergenic
1014614537 6:123584973-123584995 ATCACTTGCCTGCTACAGCATGG - Intronic
1015189917 6:130461162-130461184 TACTCTTTCCTCCCACAGCCTGG + Intergenic
1015278293 6:131405844-131405866 ATCACTTGCCTGCTACAGCATGG + Intergenic
1015663674 6:135603548-135603570 ACCCCTTGGCTTCTACAGCCTGG + Intergenic
1016114006 6:140260127-140260149 ATCACTTGCCTGCTACAGCATGG - Intergenic
1016535623 6:145105833-145105855 ATCACTTGCCTGCTACAGCATGG - Intergenic
1016933259 6:149429342-149429364 AGCCCTTTCTTCCTACTGCCAGG - Intergenic
1017769760 6:157635974-157635996 GACTCTTTCCTCCCACAGCCAGG + Intronic
1018495257 6:164341420-164341442 ATCACTTCCCTGCTACAGCATGG - Intergenic
1019797508 7:3062816-3062838 GACCCTTTCCTGCAGGAGCCTGG + Intergenic
1020316181 7:6906809-6906831 ATCACTCTCCTGCTACAGCATGG + Intergenic
1020475017 7:8583846-8583868 TATTCTTTCATGCTACAGCCCGG + Intronic
1020532581 7:9356104-9356126 ATCACTTGCCTGCTACAGCATGG - Intergenic
1022133352 7:27424444-27424466 AACCCTTTCCTGCTGCCTGCGGG - Intergenic
1022599265 7:31741657-31741679 AAAACTTTCTTGCTACAGGCAGG - Intergenic
1023550436 7:41364626-41364648 AACCCTGTGCTGGAACAGCCAGG + Intergenic
1025241729 7:57282253-57282275 ACCCCTTTCCTGTAACAGCAGGG + Intergenic
1027817707 7:82998297-82998319 AACCCTCTCATGCTTCAGGCAGG + Intronic
1028429366 7:90729620-90729642 TACCCTTTCCTGGTTCACCCTGG + Intronic
1028589759 7:92482467-92482489 ATCACTTGCCTGCTACAGCACGG - Intergenic
1029364826 7:100110029-100110051 CTCCCCTTCCTGCTGCAGCCGGG + Exonic
1030196397 7:106857699-106857721 AGCCCTTTCCCTGTACAGCCCGG + Intergenic
1030469254 7:109941962-109941984 AGCCCTTTCCTTCCACAGCTAGG + Intergenic
1031083273 7:117278485-117278507 GACCCTCTCTTCCTACAGCCTGG + Intronic
1031455321 7:121972016-121972038 CTGCCTTTCCTGCCACAGCCAGG + Intronic
1031916814 7:127571051-127571073 AGCCCTTTCCTTCTACAACTTGG + Intergenic
1032246684 7:130219327-130219349 AACCTTTCTCTGCTGCAGCCTGG + Intergenic
1032806487 7:135360055-135360077 CACCCTTTCCTTCTACAGCTAGG + Intergenic
1033625713 7:143107843-143107865 ATCACTCTCCTGCTACAGCATGG + Intergenic
1033909335 7:146246065-146246087 ATCACTTGCCTGCTACAGCATGG - Intronic
1034152808 7:148929943-148929965 AAGCCTTTCCTGTCTCAGCCAGG + Intergenic
1035986050 8:4433264-4433286 AACCATTTCCTCCCACACCCTGG + Intronic
1036017793 8:4805421-4805443 AGTCCTTGCCTACTACAGCCAGG + Intronic
1036090094 8:5656342-5656364 AACACTTTGCTGCACCAGCCAGG + Intergenic
1036838515 8:12095335-12095357 AACCCTCTTCTGCTGTAGCCAGG - Intergenic
1036860304 8:12341583-12341605 AACCCTCTTCTGCTGTAGCCAGG - Intergenic
1039876507 8:41590977-41590999 AACCCTTTCCTTCTACAACTTGG - Intronic
1039877187 8:41596802-41596824 AGCCCTTTCCTTCTACAACTTGG - Intronic
1042038801 8:64569245-64569267 AACCCTTAGATGCTCCAGCCAGG - Intergenic
1042606640 8:70552890-70552912 TGCCCTTTCCTCCTACTGCCTGG - Intergenic
1042979372 8:74508286-74508308 AACCCTTTCCTTCTACAAGCTGG - Intergenic
1043837862 8:85065999-85066021 ATCACTTGCCTGCTACAGCGTGG + Intergenic
1044232759 8:89798273-89798295 AACCCTTTCAGGTTAGAGCCTGG + Intergenic
1044258482 8:90092894-90092916 ATCACTTGCCTGCTACAGCATGG - Intronic
1044949596 8:97422705-97422727 ACCCCTTTCCTGTAACAGCTGGG + Intergenic
1048764101 8:137827505-137827527 ATCACTTGCCTGCTACAGCATGG - Intergenic
1050461960 9:5884918-5884940 ACCCCTTTCCTAATAGAGCCCGG + Intronic
1050512639 9:6412230-6412252 AATCCTTCCCTGCTACAGCTGGG - Intergenic
1055347579 9:75354464-75354486 ATCACTTGCCTGCTACAGCATGG - Intergenic
1056793499 9:89640838-89640860 AGACTCTTCCTGCTACAGCCAGG - Intergenic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1056883115 9:90415604-90415626 AACACTTGCCTGCTACAGCATGG + Intergenic
1057580898 9:96287044-96287066 ACCCCTTTCCTGTAACAACCAGG + Intronic
1058754764 9:108074146-108074168 TCCCCTTTCCTGGTCCAGCCTGG + Intergenic
1059554547 9:115266273-115266295 ATCCCATTCTGGCTACAGCCTGG + Intronic
1059651018 9:116316076-116316098 AACCATGTCCCTCTACAGCCAGG + Intronic
1060226350 9:121793356-121793378 ATCACTTGCCTGCTACAGCACGG + Intergenic
1060737742 9:126077307-126077329 ATCACTTGCCTGCTACAGCATGG - Intergenic
1062137838 9:134939029-134939051 ACCCCTCTGCTGCTGCAGCCTGG + Intergenic
1185575948 X:1172362-1172384 AAGCCCTTCCTTCTACAGCTTGG + Intergenic
1185960556 X:4543162-4543184 ATCACTTGCCTGCTACAGCATGG - Intergenic
1186887996 X:13934046-13934068 AACCCTTATCTGCTACATCCAGG - Intronic
1187103633 X:16219509-16219531 ATCATTTGCCTGCTACAGCCTGG - Intergenic
1188200825 X:27291822-27291844 ATCACTTGCCTGCTACAGCATGG - Intergenic
1188463247 X:30451781-30451803 ATCACTTGCCTGCTACAGCATGG - Intergenic
1189031659 X:37458450-37458472 ATCACTTGCCTGCTACAGCATGG - Intronic
1190381375 X:49842389-49842411 ATCCCTTTCCTGCTTCAACCTGG + Intergenic
1191761419 X:64651941-64651963 ATCACTCTCCTGCTACAGCATGG + Intergenic
1192075014 X:67985210-67985232 AAGCCCTTCCTTCTACAGCTCGG + Intergenic
1193886061 X:86984828-86984850 ATCACTTGCCTGCTACAGCATGG + Intergenic
1193941635 X:87684922-87684944 ATCACTTGCCTGCTACAGCATGG + Intergenic
1194293483 X:92102924-92102946 AACACTAGCCTGCTACAGCATGG - Intronic
1194351423 X:92827522-92827544 AACACTCACCTGCTACAGCATGG + Intergenic
1194873663 X:99162114-99162136 ATCACTTGCCTGCTACAGCATGG - Intergenic
1196074594 X:111561425-111561447 TACCCTTACCTGCTACATCACGG + Intergenic
1199693175 X:150324656-150324678 AACCCTTGGCTGATGCAGCCAGG + Intergenic
1200532708 Y:4358085-4358107 ATCACTTGCCTGCTACAGCATGG - Intergenic
1200611003 Y:5327470-5327492 AACACTAGCCTGCTACAGCATGG - Intronic