ID: 1148371053

View in Genome Browser
Species Human (GRCh38)
Location 17:47100156-47100178
Sequence GGCAGAGGAGGCGGCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148371053_1148371065 18 Left 1148371053 17:47100156-47100178 CCCTCGGGGCCGCCTCCTCTGCC No data
Right 1148371065 17:47100197-47100219 ACTCGTGCTCCCACCCCCAGGGG No data
1148371053_1148371063 16 Left 1148371053 17:47100156-47100178 CCCTCGGGGCCGCCTCCTCTGCC No data
Right 1148371063 17:47100195-47100217 CCACTCGTGCTCCCACCCCCAGG No data
1148371053_1148371064 17 Left 1148371053 17:47100156-47100178 CCCTCGGGGCCGCCTCCTCTGCC No data
Right 1148371064 17:47100196-47100218 CACTCGTGCTCCCACCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148371053 Original CRISPR GGCAGAGGAGGCGGCCCCGA GGG (reversed) Intergenic
No off target data available for this crispr