ID: 1148371395

View in Genome Browser
Species Human (GRCh38)
Location 17:47102327-47102349
Sequence AGTTAGCCTGGCGCAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148371395_1148371398 15 Left 1148371395 17:47102327-47102349 CCTGCCACTGCGCCAGGCTAACT No data
Right 1148371398 17:47102365-47102387 GAGACAGTGTTTCACAATCTTGG No data
1148371395_1148371399 20 Left 1148371395 17:47102327-47102349 CCTGCCACTGCGCCAGGCTAACT No data
Right 1148371399 17:47102370-47102392 AGTGTTTCACAATCTTGGCCAGG No data
1148371395_1148371400 24 Left 1148371395 17:47102327-47102349 CCTGCCACTGCGCCAGGCTAACT No data
Right 1148371400 17:47102374-47102396 TTTCACAATCTTGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148371395 Original CRISPR AGTTAGCCTGGCGCAGTGGC AGG (reversed) Intergenic