ID: 1148371396

View in Genome Browser
Species Human (GRCh38)
Location 17:47102331-47102353
Sequence CAAAAGTTAGCCTGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148371396_1148371399 16 Left 1148371396 17:47102331-47102353 CCACTGCGCCAGGCTAACTTTTG No data
Right 1148371399 17:47102370-47102392 AGTGTTTCACAATCTTGGCCAGG No data
1148371396_1148371398 11 Left 1148371396 17:47102331-47102353 CCACTGCGCCAGGCTAACTTTTG No data
Right 1148371398 17:47102365-47102387 GAGACAGTGTTTCACAATCTTGG No data
1148371396_1148371400 20 Left 1148371396 17:47102331-47102353 CCACTGCGCCAGGCTAACTTTTG No data
Right 1148371400 17:47102374-47102396 TTTCACAATCTTGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148371396 Original CRISPR CAAAAGTTAGCCTGGCGCAG TGG (reversed) Intergenic