ID: 1148371400

View in Genome Browser
Species Human (GRCh38)
Location 17:47102374-47102396
Sequence TTTCACAATCTTGGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148371396_1148371400 20 Left 1148371396 17:47102331-47102353 CCACTGCGCCAGGCTAACTTTTG No data
Right 1148371400 17:47102374-47102396 TTTCACAATCTTGGCCAGGCTGG No data
1148371395_1148371400 24 Left 1148371395 17:47102327-47102349 CCTGCCACTGCGCCAGGCTAACT No data
Right 1148371400 17:47102374-47102396 TTTCACAATCTTGGCCAGGCTGG No data
1148371397_1148371400 12 Left 1148371397 17:47102339-47102361 CCAGGCTAACTTTTGTATTTTTA No data
Right 1148371400 17:47102374-47102396 TTTCACAATCTTGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148371400 Original CRISPR TTTCACAATCTTGGCCAGGC TGG Intergenic