ID: 1148371996

View in Genome Browser
Species Human (GRCh38)
Location 17:47106761-47106783
Sequence CGGCAAACAGCACTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148371985_1148371996 24 Left 1148371985 17:47106714-47106736 CCCTGCTGGATCCGGAGGAATGG No data
Right 1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG No data
1148371989_1148371996 13 Left 1148371989 17:47106725-47106747 CCGGAGGAATGGAAGTCAGTGGC No data
Right 1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG No data
1148371987_1148371996 23 Left 1148371987 17:47106715-47106737 CCTGCTGGATCCGGAGGAATGGA No data
Right 1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148371996 Original CRISPR CGGCAAACAGCACTGGTGGA CGG Intergenic
No off target data available for this crispr