ID: 1148376711

View in Genome Browser
Species Human (GRCh38)
Location 17:47154672-47154694
Sequence CTTTTTTGAAGGGGCTCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 8, 1: 4, 2: 2, 3: 8, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148376705_1148376711 4 Left 1148376705 17:47154645-47154667 CCAAACTGCATTTTACATGGAAA 0: 1
1: 0
2: 2
3: 48
4: 356
Right 1148376711 17:47154672-47154694 CTTTTTTGAAGGGGCTCCGGTGG 0: 8
1: 4
2: 2
3: 8
4: 85
1148376704_1148376711 5 Left 1148376704 17:47154644-47154666 CCCAAACTGCATTTTACATGGAA 0: 1
1: 0
2: 4
3: 24
4: 275
Right 1148376711 17:47154672-47154694 CTTTTTTGAAGGGGCTCCGGTGG 0: 8
1: 4
2: 2
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148376711 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG Exonic
911566075 1:99464924-99464946 CTTTATTGATGGGGCTTGGGAGG - Intergenic
915304404 1:154969489-154969511 CCTTTGTGAAGGGGCTGGGGTGG - Intronic
917229795 1:172823589-172823611 CCTTATTGAAGGGGCTGAGGTGG - Intergenic
920714474 1:208326799-208326821 CTTTTTTGGGGGGGTTGCGGGGG - Intergenic
920797081 1:209149499-209149521 CTATTCTGAAAGGGCTCAGGTGG + Intergenic
921083171 1:211760453-211760475 CTTTTTTGAGGGGGGTTGGGGGG - Intronic
924788116 1:247219306-247219328 CTTTTTTGAGGGGGATCATGGGG - Intergenic
924804995 1:247354984-247355006 CTTTTTTGAGGGGGATCATGGGG - Intergenic
1065818143 10:29500449-29500471 GTTTCTGGAAGGGGCTCTGGAGG + Intronic
1070786412 10:79164893-79164915 CCTTTGGGAAGGGGCTCTGGAGG - Intronic
1072425682 10:95328262-95328284 CTGTTTTGAGGGTGCTCTGGTGG - Intronic
1073633954 10:105178123-105178145 CTTTGTTGACGGGGCTCTGGTGG + Exonic
1075408951 10:122213194-122213216 CTTTTTGGAAGGAGCTGCTGGGG - Intronic
1076585502 10:131544794-131544816 CTCTTTGGAAGGGGCCCTGGGGG - Intergenic
1078408448 11:11091883-11091905 CTACTTAGAAGGGGCTGCGGGGG - Intergenic
1084520288 11:69658444-69658466 CTCTGCTGAAGGGGCTTCGGTGG + Intronic
1085678298 11:78546312-78546334 TTTTTTTGGAATGGCTCCGGGGG - Intronic
1085776198 11:79368981-79369003 CTTTGTTGAGGGGGCTTTGGTGG + Intronic
1088696509 11:112370717-112370739 CTGTTTGGAAGAGGCTCTGGTGG + Intergenic
1090577042 11:128116604-128116626 CTTTTTTGAGTGGGCGTCGGGGG - Intergenic
1090658207 11:128861720-128861742 CTTTCTGGGAGGGGTTCCGGTGG - Intronic
1096234609 12:49917717-49917739 CTCCTTTGAAGGGGCTCAGAGGG - Intergenic
1100045323 12:90372997-90373019 CCTTTTTGAAGGGGGTCGGGGGG + Intergenic
1101529724 12:105562978-105563000 CTTTTTTGATGGGGCAGGGGGGG + Intergenic
1113366294 13:109679743-109679765 TTTTTTTGAAGGGGCGGGGGAGG + Intergenic
1113993544 14:16048746-16048768 CTTTTTTGAAGGGGATCCGGTGG + Intergenic
1118244738 14:64098517-64098539 CGTTTATGAAGGGGCACAGGGGG + Intronic
1118594419 14:67424781-67424803 CTGATCTGAAGGGGCTCTGGGGG - Intergenic
1121548693 14:94781761-94781783 CTGCATTGAAGGGGTTCCGGGGG - Intergenic
1122226562 14:100284246-100284268 CTTTTTTGAAAGGGGACTGGAGG - Intergenic
1123102622 14:105815731-105815753 CTTTTGGGGAGGGGCTCAGGGGG + Intergenic
1123722730 15:23074024-23074046 CTTTTTGGAAGGGATCCCGGAGG - Intergenic
1125704837 15:41724874-41724896 CTTTGTCTAAGGGGCTCCTGAGG - Intronic
1128048575 15:64641761-64641783 ATTTTTTTAAGGGTCTCCAGAGG + Intronic
1128658609 15:69481280-69481302 CATTTTTAAAGGGCCTCCCGGGG - Intergenic
1129732251 15:77939157-77939179 CTTTTTTTATGGAGCTCCCGTGG - Intergenic
1134395401 16:13858035-13858057 CTCCTTTGAAAGGGCTCCAGAGG + Intergenic
1139225092 16:65227032-65227054 ATTTTATGAAGGGGTTCAGGGGG - Intergenic
1140266189 16:73423162-73423184 ATTTTTTGCAGGGGCTGGGGAGG + Intergenic
1142411832 16:89920970-89920992 CTTTCTGGAAGGGGCTAAGGTGG - Exonic
1143469793 17:7165465-7165487 CTTTTTGGAATGTGCTTCGGAGG + Intergenic
1144185544 17:12791783-12791805 CTTCTTTGTTGGGGCTCTGGTGG + Intronic
1148145463 17:45361827-45361849 TTTCTTTGAAGGGGCTTCTGGGG - Intergenic
1148376711 17:47154672-47154694 CTTTTTTGAAGGGGCTCCGGTGG + Exonic
1148943616 17:51238313-51238335 GTTTTTCGAAGGGGCTTCAGGGG - Intronic
1150318662 17:64191337-64191359 CTCTTTTGAAGGTGCTCTGGGGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1157992139 18:52510104-52510126 TTTTTTTGAAGGGGATGCAGGGG - Intronic
1163803946 19:19385224-19385246 GTGTTTCTAAGGGGCTCCGGTGG - Intergenic
1165081525 19:33309866-33309888 CATTTTTCAAGGGGCACAGGCGG - Intergenic
1167654318 19:50753579-50753601 TTTTTTTGTGGGGGCTCGGGGGG + Intergenic
928087241 2:28353369-28353391 TTTTTTTGGAGGGGGTGCGGGGG + Intergenic
930082208 2:47460234-47460256 CTGTTTTGAAAGGGCTGCTGAGG - Intronic
932629729 2:73329433-73329455 TTTTATGGAAGGGGCTCAGGGGG + Intergenic
934548153 2:95235853-95235875 CTCTTTTGAACTGGCTCCTGTGG - Intronic
934621376 2:95810590-95810612 CTTTGTTGAATGGGCTACTGTGG + Intergenic
934812066 2:97288224-97288246 CTTTGTTGAATGGGCTACTGTGG - Intergenic
934825627 2:97419703-97419725 CTTTGTTGAATGGGCTACTGTGG + Intergenic
937224939 2:120363333-120363355 CTTTTCTGGAGAGGCTCCTGAGG - Intergenic
938538137 2:132262122-132262144 CTTTTTTTAAGGGGATCCGGTGG - Intergenic
941637121 2:167946503-167946525 CTTTCTTTAAGAGGCTCCAGGGG + Intergenic
942625418 2:177895160-177895182 CTTTTTTGGAGGTGCTCTGAGGG + Intronic
1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG + Intronic
1171811490 20:29747113-29747135 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1171867043 20:30493907-30493929 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1171908179 20:30918626-30918648 CTTTTTTGGAGGGACTCCAGTGG + Intergenic
1172609547 20:36239910-36239932 CTTCTTTGAAGGGGCCACTGTGG + Exonic
1175952630 20:62591441-62591463 CTGTCTTGATGGGGCTCAGGTGG + Intergenic
1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1180045191 21:45301930-45301952 CTTTTCTGACGGGGCCCCCGGGG + Intergenic
1180313724 22:11258767-11258789 CTTTTTTGAAGGGGATCCGGTGG - Intergenic
1180341616 22:11624788-11624810 CTTTTTTGAAGGGACTCCGGTGG + Intergenic
1185053297 22:48564894-48564916 CTTTTTTGCAGGGCCACTGGGGG - Intronic
1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
952227432 3:31392735-31392757 CCTTTTTGAAGGTGCTGAGGTGG - Intergenic
953089055 3:39705425-39705447 CTTTTTTGTGGGGGCTCCAGAGG - Intergenic
962246497 3:133799601-133799623 CTTTTTTCAAGTGGCTCTCGGGG + Intronic
968805195 4:2767604-2767626 CGTTTGTGAAAGGGCTCCCGGGG - Intergenic
972848110 4:43014312-43014334 CTTTTTTGGTGGGGCTCAGGTGG + Intronic
975733074 4:77356419-77356441 CCTTGTTGAAGGGGATCTGGTGG + Intronic
976412729 4:84735310-84735332 CTTCCTTGAAGGGGCTTTGGGGG - Intronic
989471118 5:41819798-41819820 ATTTTATGAAGGGGCTCTGTGGG + Intronic
991014342 5:61915320-61915342 ATTTTTTCAAGGGGGTCCCGGGG - Intergenic
999837882 5:155394184-155394206 CTTTTCAGAGGGGGCTCAGGAGG - Intergenic
1000833775 5:166132216-166132238 CTTTTTTGAGGCGGTTCCTGGGG + Intergenic
1000840459 5:166211573-166211595 CTTTTTTGAAAAGCCTCAGGGGG - Intergenic
1018764460 6:166922381-166922403 TTTTTTTGATGGGGAGCCGGGGG - Intronic
1022090128 7:27102538-27102560 CTCTTTTGGAGGGGCTTTGGGGG + Exonic
1023079235 7:36512184-36512206 ATCTTTTGAATGGGCTCAGGTGG - Intergenic
1023810514 7:43907647-43907669 CTATCTTGCAGGGGCTCCTGGGG - Intronic
1027726970 7:81818912-81818934 CATTTTTTATGGGGCTCAGGGGG + Intergenic
1032794759 7:135268706-135268728 TTTTATTGAAGGAGCTCTGGAGG + Intergenic
1036953441 8:13162778-13162800 CTTTTTTGAGGGGGCTGGGGAGG - Intronic
1038045430 8:23761877-23761899 CTTTTTTGCAGTGGTGCCGGGGG - Intergenic
1049253973 8:141604286-141604308 CTTTTTTAACGGGGCTGCTGTGG - Intergenic
1050436441 9:5615364-5615386 CTTTTTTGAAGGGGGTGAGGAGG - Intergenic
1053340005 9:37317836-37317858 CTTTTTTGGGGGGGGTCGGGGGG - Intronic
1059544724 9:115164785-115164807 CTTTTTTGTAGTTGCTCCAGTGG + Intronic
1061034744 9:128107261-128107283 CTCTATTGAGGGCGCTCCGGAGG + Exonic
1203474692 Un_GL000220v1:141109-141131 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1203362116 Un_KI270442v1:224979-225001 CTTTTTTGAAGGGGCTCTGGTGG - Intergenic
1187535841 X:20141386-20141408 CATTTTTGTAGGGCCTCCTGCGG - Intronic
1193730497 X:85096847-85096869 TTTTTTTGAGGGGGCTGGGGTGG - Intronic
1200789181 Y:7284579-7284601 CATTCTCGAAGGGGCTCCTGTGG - Intergenic
1201076204 Y:10191343-10191365 ATTTTTTGAAGGGTCTCCGGTGG + Intergenic