ID: 1148377065

View in Genome Browser
Species Human (GRCh38)
Location 17:47158194-47158216
Sequence ATGTGAAATAGGTAGGTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148377065_1148377076 28 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377076 17:47158245-47158267 GATTTAAACTAAGGCTCTTTTGG 0: 6
1: 2
2: 7
3: 16
4: 186
1148377065_1148377071 -9 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377071 17:47158208-47158230 ATTTCACATAATGATTCAAAGGG 0: 4
1: 10
2: 2
3: 34
4: 385
1148377065_1148377075 19 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377075 17:47158236-47158258 AGAGGAAAGGATTTAAACTAAGG 0: 5
1: 3
2: 5
3: 30
4: 377
1148377065_1148377073 6 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377073 17:47158223-47158245 TCAAAGGGAGACCAGAGGAAAGG 0: 1
1: 8
2: 10
3: 40
4: 400
1148377065_1148377072 1 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377072 17:47158218-47158240 ATGATTCAAAGGGAGACCAGAGG 0: 1
1: 8
2: 4
3: 13
4: 193
1148377065_1148377070 -10 Left 1148377065 17:47158194-47158216 CCACCCACCTACCTATTTCACAT 0: 1
1: 0
2: 1
3: 10
4: 262
Right 1148377070 17:47158207-47158229 TATTTCACATAATGATTCAAAGG 0: 5
1: 12
2: 1
3: 30
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148377065 Original CRISPR ATGTGAAATAGGTAGGTGGG TGG (reversed) Exonic
900763639 1:4489030-4489052 ATGTGAAATCGCTTGGTGTGCGG + Intergenic
900893042 1:5463484-5463506 ATATGAATTTGGTGGGTGGGGGG - Intergenic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
904963114 1:34350282-34350304 TTGTTGAATGGGTAGGTGGGTGG - Intergenic
908014493 1:59816366-59816388 ATTTGAAATAGGTATTGGGGTGG + Intronic
908866960 1:68559042-68559064 AGGAGAAATTGGTAGTTGGGGGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
912802199 1:112727073-112727095 ATGCGAAAGAGGGAGGTGGTGGG - Exonic
912961923 1:114203601-114203623 ATGTGAAATAGGGAGGAAGAGGG + Intergenic
913582738 1:120243053-120243075 AGGAGAAAGAGGCAGGTGGGAGG - Intergenic
913625435 1:120655307-120655329 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914564668 1:148854547-148854569 AGGAGAAAGAGGCAGGTGGGAGG - Intronic
914608158 1:149275695-149275717 AGGAGAAAGAGGCAGGTGGGAGG + Intergenic
914831229 1:151172411-151172433 TTCAGAAATAGGTAGGAGGGAGG - Intronic
915656768 1:157367093-157367115 ATGTGAGAGAGGCAGGTGGCAGG - Intergenic
915672191 1:157499142-157499164 ATGTGAGACAGCCAGGTGGGAGG + Intergenic
915759166 1:158293328-158293350 ATGTGAAATAAGAAACTGGGAGG - Intronic
916209820 1:162351421-162351443 ATGTGTAATCGGTCTGTGGGTGG - Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918269099 1:182878851-182878873 ACATGAACTAGGAAGGTGGGAGG + Intronic
919307076 1:195855874-195855896 GTGGGAAAAAGGTAAGTGGGAGG + Intergenic
919612618 1:199764197-199764219 ATGTGAAAAAGGTATTTGGATGG - Intergenic
920598917 1:207302614-207302636 GTGTGAAATAGGTGAGGGGGAGG + Intergenic
920940602 1:210478484-210478506 TGGTGAAATAGGAAGGTGAGGGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921574838 1:216822592-216822614 AAGTGAATTAGGCAGGTGTGTGG + Intronic
922615254 1:226957289-226957311 GTGTGAACCAGGGAGGTGGGGGG - Intronic
923469211 1:234275532-234275554 AGCTGAGATAGATAGGTGGGTGG + Intronic
924354690 1:243159557-243159579 TTATGAAATAAGTAGATGGGGGG - Intronic
1063021045 10:2127846-2127868 AAGGAAAACAGGTAGGTGGGTGG - Intergenic
1063119773 10:3097180-3097202 AAGTACAATAGGTAGGTAGGCGG - Intronic
1066526723 10:36288234-36288256 ATGAGAATCAGGTGGGTGGGTGG - Intergenic
1066757716 10:38727645-38727667 CTGTGGTATAAGTAGGTGGGAGG - Intergenic
1068939327 10:62665261-62665283 ATAGGAAATAGGGAGGTGGGAGG - Intronic
1069819399 10:71218087-71218109 ATGTGTATTAAGCAGGTGGGCGG + Intronic
1070252378 10:74784261-74784283 ATGTGAAGTAGGGAGGGGAGGGG + Intergenic
1070258141 10:74827442-74827464 ATGGGAAAGAGGTATCTGGGTGG + Intronic
1070540724 10:77413388-77413410 AGGTGAAAGAGGTTGCTGGGTGG - Intronic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1074390404 10:113052835-113052857 ATGTCTAATAGAAAGGTGGGAGG - Intronic
1074579199 10:114701386-114701408 ATGTGGAATTGCTAGGTCGGAGG - Intergenic
1075198620 10:120382775-120382797 AGGTGAATGAGGTGGGTGGGTGG - Intergenic
1077571040 11:3338889-3338911 ATGTGAAAGTGGTAGGGGAGGGG + Intergenic
1078002826 11:7511903-7511925 CTGTGAAATAGGTAGGTAATAGG - Intergenic
1079638704 11:22777713-22777735 ATGTAAGAAAGGTAGGTTGGGGG + Intronic
1080111596 11:28574227-28574249 AACTGTTATAGGTAGGTGGGGGG + Intergenic
1080711158 11:34749201-34749223 ATGCCAGATAGGTAGGAGGGAGG - Intergenic
1081086124 11:38803678-38803700 ATCAGAAATATGAAGGTGGGTGG + Intergenic
1081116986 11:39214925-39214947 AGCTAAAATAGGTAGGTGTGGGG + Intergenic
1083172172 11:60929482-60929504 GGGTGAACTGGGTAGGTGGGTGG - Intronic
1083828864 11:65218320-65218342 ATGAAACATAGGTAGGTGGCAGG - Intergenic
1085548923 11:77348741-77348763 AGGTGAAATAGTTAGATGGAGGG - Intronic
1086354791 11:85984412-85984434 ACGGAAAATGGGTAGGTGGGAGG - Intronic
1087635214 11:100694572-100694594 AGGTGAAATTGGTGGGTGGCAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088993323 11:114973363-114973385 ATGTGAAATCTGTAGCTAGGAGG - Intergenic
1089003861 11:115074627-115074649 ATCAGAAATAGGTAGGAGGATGG + Intergenic
1090391731 11:126393306-126393328 ATGTGAGGTGGGTAGCTGGGTGG + Intronic
1091058257 11:132438865-132438887 TGGGGAAATGGGTAGGTGGGTGG - Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092803937 12:12201410-12201432 AGCTGAAATAGGAGGGTGGGAGG - Intronic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1094112093 12:26872821-26872843 ATGTATAATAGGTGGTTGGGTGG - Intergenic
1094635975 12:32227369-32227391 GTGGGAAACAGGGAGGTGGGAGG + Intronic
1096104629 12:48989797-48989819 ATGACAAATAGGTTGGTGGATGG + Intergenic
1097037530 12:56133684-56133706 ATGGGAAATAGGAAGCTGGCAGG + Intronic
1099437992 12:82666549-82666571 ATGTCAAATAGGTAGATGTATGG + Intergenic
1102449326 12:113029126-113029148 ACTTGAGATAGGTAGGGGGGTGG + Intergenic
1102507051 12:113390298-113390320 GTGACAAATAGGTAGGTGGATGG - Exonic
1102751186 12:115296170-115296192 ATTTGAATTAAGTAGGTTGGGGG - Intergenic
1103593827 12:122010952-122010974 ATGGGAAGTGGGTAGGTGGCGGG + Intergenic
1104766060 12:131331074-131331096 ATGGTGGATAGGTAGGTGGGTGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1106456159 13:29929190-29929212 ATGGGAAATGGGGAGGAGGGAGG + Intergenic
1107318873 13:39165001-39165023 ATATGAAATATGAAGGAGGGAGG + Intergenic
1107350260 13:39506707-39506729 AGGTGGGATAGGGAGGTGGGGGG + Intronic
1107362514 13:39635056-39635078 ATGTCATAAAGGTTGGTGGGGGG + Intergenic
1107747291 13:43524094-43524116 ATGTGAAGAAGGTGGTTGGGTGG - Intronic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1112965757 13:105191299-105191321 ATGTTAAATATGTAGATGGCTGG - Intergenic
1113126945 13:106989816-106989838 ATCTGAAATATCTTGGTGGGAGG + Intergenic
1114481186 14:23035818-23035840 ATTTGAAAAATGAAGGTGGGTGG - Intergenic
1115758721 14:36556573-36556595 ACGTGAAGGAGGCAGGTGGGTGG + Intergenic
1115883312 14:37944962-37944984 ACTTGAAATAGGGGGGTGGGGGG + Intronic
1120885315 14:89447376-89447398 ATGTGAGTTAAGAAGGTGGGCGG + Intronic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1124184270 15:27509300-27509322 ATATGATATATGTAGTTGGGGGG + Intronic
1127965815 15:63922160-63922182 CAGTGAGATAGGAAGGTGGGTGG - Intronic
1129718798 15:77866643-77866665 GAGTGAAATAGGGAGATGGGGGG - Intergenic
1133353715 16:5120533-5120555 ATGTGAAATAGGGATGATGGTGG - Intergenic
1133432734 16:5752499-5752521 GCGTGAAACAGCTAGGTGGGTGG - Intergenic
1133825086 16:9271115-9271137 ATGTATAATAGGTGGGTGGATGG - Intergenic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1137765020 16:50971416-50971438 ATGAGAAATGGGTGGGTGAGTGG - Intergenic
1138152368 16:54670457-54670479 ATGTTAAATAGGTAAGGGGTGGG + Intergenic
1138943614 16:61820675-61820697 ATGGGTAATAGGTAAGTTGGAGG + Intronic
1139871003 16:70108595-70108617 GGGTGTAATAGGTAGGCGGGTGG + Intergenic
1140362494 16:74356393-74356415 ATGTGAAGAAAGCAGGTGGGGGG + Intergenic
1140375870 16:74445278-74445300 GGGTGTAATAGGTAGGCGGGTGG - Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1142174484 16:88638957-88638979 TGGTGAAACAGGCAGGTGGGTGG - Intronic
1142804366 17:2363724-2363746 GTGTGAAACAGGGAGTTGGGAGG - Intronic
1143673285 17:8411747-8411769 ATGTGAAATAGGGGCGTGTGTGG - Intergenic
1143887840 17:10078709-10078731 GTGTAAAATTGGTAGGTAGGGGG + Intronic
1148160719 17:45448568-45448590 AAGTGAATTAGGTAGATGGGTGG + Intronic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1149203300 17:54213683-54213705 ATCTGAAATAGGGAGGTGAGGGG - Intergenic
1149374343 17:56029238-56029260 GTGTGAAATAGATAGTTTGGGGG + Intergenic
1150392004 17:64795433-64795455 AAGTGAATTAGGTAGATGGGTGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152642258 17:81454175-81454197 ATGTGAAATGGGGCAGTGGGAGG + Intronic
1156214751 18:34986075-34986097 ATTTGAAGTAGGTAGGAGGTAGG + Intronic
1157095689 18:44683644-44683666 ATGAGAAATAGCTAGCTGGATGG + Intronic
1157543188 18:48526872-48526894 AGGTGAAATGGGAAGATGGGAGG + Intergenic
1159456998 18:68671408-68671430 ATGTGAAAAATTTAGATGGGTGG + Intergenic
1160926818 19:1550416-1550438 ATGTTGAATGGGTGGGTGGGTGG - Intergenic
1161565586 19:5000182-5000204 ATGGTAGATAGGTGGGTGGGTGG - Intronic
1163492724 19:17626376-17626398 ATGAGGGATGGGTAGGTGGGTGG - Intronic
1164601560 19:29566616-29566638 AGGTGAGATAGGTAGAGGGGAGG + Intergenic
1165724596 19:38103973-38103995 ATGAGAAGTAGCTGGGTGGGTGG + Intronic
1166081440 19:40446164-40446186 GAGGGGAATAGGTAGGTGGGTGG + Intergenic
1166257581 19:41617600-41617622 AAGTGAGAGAGGGAGGTGGGAGG + Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166565966 19:43765680-43765702 ATGTGAAACGGGTATGTGGGTGG + Intergenic
1167778725 19:51581253-51581275 ATGTGAAATAGGTGTTTGGTGGG + Intronic
1168695074 19:58399697-58399719 AAGTGAAAGAGGGAGGTAGGAGG - Intergenic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925742079 2:7014762-7014784 ATTTGAAAGAGGTAGGTGCCTGG + Exonic
927407022 2:22782123-22782145 ATCAGAAATAAGTAGGTGGTGGG + Intergenic
929333688 2:40714158-40714180 ATGTGAAATAGTTAGCTGTTTGG - Intergenic
930189429 2:48442202-48442224 ATGTGATGAAGGGAGGTGGGTGG + Intronic
931039784 2:58284495-58284517 ATGTGGAATTGGTTGGGGGGGGG - Intergenic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932987928 2:76748923-76748945 ATGAGAAATAGAAAGATGGGTGG + Intronic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
937094266 2:119225272-119225294 ATGTCTAATGGGTAAGTGGGCGG + Intronic
937583004 2:123512207-123512229 ATGTGAATTAATTAGGTTGGTGG + Intergenic
937700990 2:124862806-124862828 ATGTGAAATGAGTTAGTGGGAGG + Intronic
939091308 2:137782861-137782883 GTGTGTAATAGCTAGGTAGGAGG + Intergenic
941778913 2:169423397-169423419 ATGTGAAATTGTTGGGTGGAAGG - Intergenic
942901841 2:181129587-181129609 ATGTAAAATAGGTGATTGGGGGG - Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
944320831 2:198339819-198339841 TTGGGAACTGGGTAGGTGGGGGG + Intronic
946031086 2:216705753-216705775 GTGAGAAAAAGGTAGGTAGGTGG - Intergenic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
1168981100 20:2004366-2004388 ATTTGAGAAAGGTAAGTGGGAGG + Intergenic
1168984475 20:2036390-2036412 ATGAGTAGTAGGTAAGTGGGTGG + Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1170646847 20:18204120-18204142 ATGTGAAGTAGGCCGGTCGGGGG - Intergenic
1172035879 20:32010474-32010496 AAGGGAAGAAGGTAGGTGGGAGG + Exonic
1175231195 20:57474415-57474437 ATGTGGAAAAGGGAGGTAGGAGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1176015724 20:62930586-62930608 ATGTGAAATAGGAAAAAGGGAGG + Intronic
1177775116 21:25559255-25559277 ATATGAATTTGGGAGGTGGGGGG + Intergenic
1182052627 22:27324873-27324895 ATGATAAATAGGTAGGTTGATGG + Intergenic
1182082551 22:27539492-27539514 ATGTGAAATGGGTATGTGTTGGG - Intergenic
1182655231 22:31884748-31884770 ATGTCAAGTAGGTAGCTGGAGGG - Intronic
1183327937 22:37204557-37204579 ATGAGAAATGGGCAGTTGGGGGG - Exonic
1184626445 22:45735399-45735421 ATATGATATAGGTAGGTGGGAGG - Intronic
949450884 3:4183884-4183906 ATGGCAATTAGGGAGGTGGGTGG + Intronic
950682894 3:14597277-14597299 ATGAGAAATAGGGAACTGGGTGG + Intergenic
951044844 3:18026568-18026590 AAGAGAAATAGGAAGGAGGGGGG - Intronic
951531969 3:23706371-23706393 ATGAGTAATAGGTATGGGGGCGG - Intergenic
952167076 3:30762025-30762047 ATGTGACGTGGGTAGGTGAGAGG + Intronic
953124098 3:40075001-40075023 ATGTGAAATAAGTAGGTTACAGG + Intronic
953176628 3:40559381-40559403 GTGTGTAATAGGTAGGTAGAAGG - Intronic
954750219 3:52809378-52809400 ATGATGAATAGGTAGCTGGGGGG - Intergenic
955783415 3:62510170-62510192 TGCAGAAATAGGTAGGTGGGAGG - Intronic
955884016 3:63578278-63578300 ACTTGAAATAGGTAGGGAGGAGG + Intronic
956184887 3:66552988-66553010 ATGAGAAATAGGCAGGTCTGAGG - Intergenic
956741611 3:72280147-72280169 ATGGGAAATGAGTGGGTGGGTGG - Intergenic
956949366 3:74263086-74263108 ATGTGAAATTGGTAGGAAAGAGG + Exonic
958042388 3:88242913-88242935 GTATGAAATAGGTAGTTGAGTGG + Intergenic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
958715701 3:97777370-97777392 ATTTTATATAGGTAGGAGGGTGG - Intronic
958786581 3:98603247-98603269 AAGTGAAATGGGGGGGTGGGAGG + Intergenic
958930909 3:100206978-100207000 AGGAGAAATTGGTAAGTGGGAGG - Intergenic
960129236 3:114036600-114036622 ATGAGACATAAGCAGGTGGGAGG - Exonic
960355603 3:116649299-116649321 ATGTGATACGGGTTGGTGGGTGG + Intronic
961386290 3:126525053-126525075 GTGTGAAATGGGTTGATGGGAGG - Intronic
964809913 3:160652441-160652463 ATATGAATTGGGTGGGTGGGGGG - Intergenic
964958165 3:162388441-162388463 TTGTGAAATTGGGAGGAGGGAGG - Intergenic
965826932 3:172741033-172741055 TTGTGAACGAGGTTGGTGGGGGG + Intergenic
966786037 3:183623626-183623648 ATGTGAAATACTTAGTTGGAGGG + Intergenic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
972792360 4:42385189-42385211 ATGTGAAACAGGTAGCAGGCTGG - Intergenic
972928109 4:44037646-44037668 CTGGGAAGTAGTTAGGTGGGTGG - Intergenic
973138171 4:46732626-46732648 ATGTGAAATTGGTAGGTCTTAGG - Intergenic
975829562 4:78355301-78355323 ATGTATAATAAGTATGTGGGGGG - Intronic
980947530 4:139337275-139337297 ATGTGATAGTGGTAGGTGGTGGG + Intronic
981904812 4:149910199-149910221 ATAGGATATAGGAAGGTGGGTGG + Intergenic
984227532 4:177052931-177052953 ATGGGAAAAAGTTAGGAGGGGGG + Intergenic
987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG + Intronic
988715965 5:33828743-33828765 ATGAGAAATATGTATGTGGTTGG + Intronic
989126621 5:38059814-38059836 ATGTGAAACAAGAAGTTGGGGGG - Intergenic
989640956 5:43582605-43582627 GTGTGAGATTGGTAGGTTGGAGG + Intergenic
989677404 5:43987611-43987633 AGGTGAAATAGCAAGGTTGGAGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991476792 5:67029786-67029808 ATGTGAAAAAGGTAGGAGAAAGG + Intronic
994348091 5:98711590-98711612 ATGTTAGATAGTTAGGTGAGTGG - Intergenic
994640377 5:102401131-102401153 ATCTGAAAAAGGTAAGTGAGTGG + Intronic
994730011 5:103480974-103480996 AGGCTAAAGAGGTAGGTGGGAGG - Intergenic
995271807 5:110228184-110228206 TGGTGAAATGGGTAGGTGGGTGG - Intergenic
996409049 5:123137034-123137056 ATGTGAAATAGGTTAATGGATGG + Intronic
998360184 5:141578974-141578996 ATGTAAAATATATAGTTGGGAGG + Intronic
998756279 5:145384231-145384253 ATGTGAAACAGGTTGGTAAGTGG - Intergenic
999351457 5:150875464-150875486 TTGGGAAATAGGTATGTGGATGG + Intronic
999639338 5:153655952-153655974 ATGTGAACTGAGTAGGTGGAAGG + Intronic
1002331316 5:178442858-178442880 TTGTGAAATAGGGATATGGGAGG - Intronic
1005223906 6:23619960-23619982 ACATTAGATAGGTAGGTGGGGGG + Intergenic
1006460383 6:34154524-34154546 ATGTGACATGGGTGGGTGGTCGG + Intronic
1007656283 6:43452993-43453015 CTGTGACAAAGGTAGGGGGGAGG - Exonic
1010406481 6:75511772-75511794 ATGTTAAATAGTTGTGTGGGAGG - Intergenic
1010648587 6:78424310-78424332 ATATTAAAAAGCTAGGTGGGAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013156109 6:107491578-107491600 ATGGAAAATAAGGAGGTGGGGGG - Intronic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013956276 6:115844960-115844982 AGCTGAGATGGGTAGGTGGGGGG - Intergenic
1015862440 6:137695077-137695099 GTGTGGAATAGGCAGGTTGGGGG + Intergenic
1016576177 6:145571959-145571981 TTGGGGAATAGGTAGGTGGATGG - Intronic
1018798054 6:167202431-167202453 ATGTAAAATCGGTTTGTGGGTGG - Intergenic
1018813469 6:167314442-167314464 AGGCGAAGTAGGCAGGTGGGGGG - Intronic
1018814658 6:167321740-167321762 ATGTAAAATCGGTTTGTGGGTGG + Intergenic
1022044859 7:26614547-26614569 ATGTGAAACAGGAAGCCGGGAGG + Intergenic
1023234548 7:38070614-38070636 ATGTGATATAAGTTTGTGGGAGG + Intergenic
1023706644 7:42948197-42948219 GTGTGAAAAAGGTAAGAGGGAGG - Intronic
1024295915 7:47842316-47842338 ATGAGAAAGAGTTAGATGGGAGG - Intronic
1024655130 7:51445950-51445972 AGGTGAAACAGTCAGGTGGGAGG + Intergenic
1030584495 7:111400698-111400720 ATGTGAAATGCTTAGGTGTGAGG + Intronic
1030593483 7:111508750-111508772 ATGTGAAATAGGTGAATGGTGGG + Intronic
1031014812 7:116562021-116562043 ATGAGAAAGAGGTAGATGGAGGG + Intergenic
1032247844 7:130228412-130228434 AGGTCAAAGAGGTGGGTGGGAGG + Intergenic
1034209569 7:149351446-149351468 ATTTGAAATATGCAGGAGGGTGG + Intergenic
1035070418 7:156140575-156140597 AGGAGAAAGAGGCAGGTGGGGGG + Intergenic
1035330332 7:158092450-158092472 ATGAAAAATTGATAGGTGGGTGG + Intronic
1035476359 7:159146509-159146531 ATGATAAATAGGTAGATGGTAGG - Intergenic
1036979458 8:13453075-13453097 ATGAGAAATAGGTAAGTGACTGG + Intronic
1038076417 8:24080189-24080211 ATGTATAATAGGGAGGTTGGGGG + Intergenic
1038131949 8:24742303-24742325 ATGTAAAACAGGTAGGTAGTGGG - Intergenic
1039085833 8:33778512-33778534 ATGAGACATAAGTGGGTGGGAGG + Intergenic
1040353830 8:46596008-46596030 ATGGGGAATAGGTGGGTGGGTGG + Intergenic
1041193024 8:55372608-55372630 ATTTGGATTGGGTAGGTGGGTGG + Intronic
1042957185 8:74263627-74263649 ATGTGAAATGGCTGGGTAGGGGG - Intronic
1044202808 8:89456578-89456600 ATGTCCAACAGGTAGGTGGTGGG + Intergenic
1044273862 8:90277605-90277627 TGATGAAATAGGTAGGTGGAAGG - Intergenic
1044878847 8:96701422-96701444 ATTTGAAGTAGTTAGATGGGTGG + Intronic
1045061931 8:98418452-98418474 GTGTGGGATAGGTACGTGGGTGG + Intronic
1045576848 8:103431761-103431783 ATGAGTGTTAGGTAGGTGGGAGG - Intronic
1046856841 8:119041957-119041979 ATATGAAATAGGCAGGAGGTAGG + Intronic
1047012452 8:120686581-120686603 ATGTGAATTTGGGGGGTGGGGGG + Intronic
1051021565 9:12549923-12549945 TTTTGAAATAGGTTGTTGGGTGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1053206123 9:36188090-36188112 ATGTGAAGGAGGTAGAGGGGTGG - Intergenic
1053288071 9:36862647-36862669 GTCTGAAGCAGGTAGGTGGGCGG + Intronic
1054801895 9:69358152-69358174 AAGTGAGAATGGTAGGTGGGTGG - Intronic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1057824260 9:98360096-98360118 GTCTGAAGTAGGTAAGTGGGAGG + Intronic
1058544741 9:106049031-106049053 ATGTGTACTAGGTATTTGGGTGG + Intergenic
1059880531 9:118683994-118684016 ATGTTAAAAATATAGGTGGGAGG + Intergenic
1060196929 9:121629756-121629778 ATGTGACTGAGGCAGGTGGGTGG + Intronic
1060554075 9:124499406-124499428 AAGCTAGATAGGTAGGTGGGTGG - Intronic
1186216473 X:7306562-7306584 ATGTTGAACTGGTAGGTGGGTGG + Intronic
1186689027 X:11955258-11955280 ATATGAATTTGGTTGGTGGGTGG + Intergenic
1186747995 X:12589903-12589925 ATGTGGATTTGGTAGGTGGAAGG - Intronic
1188079272 X:25815796-25815818 AAGAGAAATAGGTAGATGAGAGG - Intergenic
1188754705 X:33948023-33948045 GTCTGAGATTGGTAGGTGGGGGG - Intergenic
1190074938 X:47310007-47310029 ATGTGGAGTTGGGAGGTGGGAGG + Intergenic
1191672961 X:63766007-63766029 ATAAGAAATATGTATGTGGGTGG - Intronic
1192408968 X:70915566-70915588 ATGTGAATAAGGTAAGTGAGTGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic