ID: 1148378921

View in Genome Browser
Species Human (GRCh38)
Location 17:47177663-47177685
Sequence TAGGACCCTCAAAATAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148378917_1148378921 2 Left 1148378917 17:47177638-47177660 CCTTAAGCAATTTTGAACTCTGG 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1148378921 17:47177663-47177685 TAGGACCCTCAAAATAACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1148378916_1148378921 30 Left 1148378916 17:47177610-47177632 CCACATTAATTTAAGATAAAACA 0: 1
1: 0
2: 2
3: 50
4: 671
Right 1148378921 17:47177663-47177685 TAGGACCCTCAAAATAACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148378921 Original CRISPR TAGGACCCTCAAAATAACCT AGG Intronic
902613937 1:17613458-17613480 TAGGACCCTTGCAATCACCTGGG + Intronic
903603974 1:24561471-24561493 TGGGACCCTAAAAGTAATCTGGG + Intronic
904980606 1:34497761-34497783 CAGGACCCAAAAAATGACCTAGG - Intergenic
907458569 1:54591877-54591899 TTGGAACCTCAGAATAAGCTTGG - Intronic
910884881 1:91953690-91953712 AATAACTCTCAAAATAACCTTGG - Intronic
918744919 1:188186790-188186812 CATGACACTCAAAATAACATGGG - Intergenic
921408470 1:214808703-214808725 TATGATCCTCACAATAAACTCGG + Intergenic
924723101 1:246641864-246641886 TAGGAAGCTGAAAATAACTTGGG - Intronic
1066510391 10:36089095-36089117 TACGACCCTGAATATAACCTTGG + Intergenic
1069435532 10:68378968-68378990 TAGGACCCTCAACCCAACCGAGG - Intronic
1069527958 10:69190644-69190666 TAAGACCCTGAAAAGAACCCTGG - Intronic
1073615473 10:104990668-104990690 TGGGTCCCTCAAGATAATCTGGG - Intronic
1073645060 10:105293460-105293482 TGGGACCCTGAAATTAACATAGG - Intergenic
1075360722 10:121830443-121830465 TAGGACCCTCACCAGAAGCTGGG + Intronic
1075772405 10:124950769-124950791 TAGGACTCTAAAACCAACCTGGG + Intronic
1081248083 11:40794745-40794767 TAGGACTCATCAAATAACCTAGG + Intronic
1081625847 11:44654601-44654623 TAGAACGCTCAAAGTAACATTGG - Intergenic
1088090412 11:106032161-106032183 TTGGACCAACAAAATAATCTAGG - Intergenic
1089097970 11:115935516-115935538 TAGGACCCTCTTCAAAACCTAGG + Intergenic
1090163796 11:124523923-124523945 TAGAGTCCTCAGAATAACCTTGG - Intergenic
1090938151 11:131363637-131363659 GAGAACTCTCAAAATAACATTGG - Intergenic
1093901238 12:24636205-24636227 TGGGACCCTCAACATACTCTGGG - Intergenic
1094180320 12:27585739-27585761 GAGGAGCTTCAATATAACCTGGG + Intronic
1094668641 12:32546977-32546999 TAGGAGCTTCAAAATACCCAGGG - Intronic
1096086632 12:48869465-48869487 TATGACCCACAAAATATCCTTGG - Intergenic
1097450350 12:59730684-59730706 AATGACTCTCAAAATAAACTAGG - Intronic
1099721212 12:86364093-86364115 CAGGACCAACAAAATTACCTGGG - Intronic
1103137891 12:118523456-118523478 AAGGACTCTTAAAATTACCTTGG - Intergenic
1103731398 12:123030147-123030169 AAGGACCCTTGAGATAACCTGGG + Intronic
1106385963 13:29286317-29286339 TATTTCCTTCAAAATAACCTAGG + Intronic
1109990216 13:70044926-70044948 TATGACTCACAGAATAACCTTGG + Intronic
1111211644 13:85087478-85087500 TAGCTCCCTCCAAAGAACCTAGG - Intergenic
1113571664 13:111362347-111362369 AAGGAACATGAAAATAACCTGGG + Intergenic
1114303268 14:21397179-21397201 TAGGACCCTCAAAGGAAATTGGG - Intronic
1116635961 14:47396379-47396401 TAGGACTCTAGAAAAAACCTAGG + Intronic
1119109575 14:71958892-71958914 TAGCAGTCTCAGAATAACCTGGG - Intronic
1124692687 15:31838816-31838838 GAGGACCCTCAAAATGAGTTAGG - Intronic
1126328764 15:47509775-47509797 TAGGAACATCAACATCACCTAGG + Intronic
1130356712 15:83139476-83139498 TGGGACACTAAAAATACCCTAGG - Intronic
1133588122 16:7215618-7215640 TATAACCCTCAAAAGATCCTCGG + Intronic
1134634298 16:15780306-15780328 CAGGACTCCCAAAATATCCTTGG - Intronic
1135956120 16:26958007-26958029 AAGGATCCTCAGGATAACCTGGG - Intergenic
1148378921 17:47177663-47177685 TAGGACCCTCAAAATAACCTAGG + Intronic
1160313296 18:77818016-77818038 GAAGACCATCAAAATAACCAAGG - Intergenic
1164827895 19:31297808-31297830 GAGGACACTCAAAATAAACCAGG + Intronic
1168413481 19:56154655-56154677 TGGGACCCTCAACAGAACATCGG + Intronic
931642969 2:64397415-64397437 GATGTCCCTCAAAAAAACCTTGG - Intergenic
932365443 2:71149623-71149645 TAGGGTCCTCACAATAACCTGGG + Intronic
933625903 2:84598660-84598682 AAGGTCCCTCAAAATAACAAGGG - Intronic
935593020 2:104857824-104857846 AAGTATCCTCAAAGTAACCTTGG + Exonic
938443044 2:131352868-131352890 GAGGACCCTGAAAGAAACCTGGG + Intronic
940700362 2:157033512-157033534 TATGATCCCTAAAATAACCTTGG + Intergenic
942320665 2:174732981-174733003 CAGGCCCCTCCAAATACCCTTGG + Intergenic
942775720 2:179580249-179580271 TTGGACCCACAGAATACCCTGGG - Intronic
942866816 2:180686408-180686430 TATGAGCCTAAAAATAGCCTGGG - Intergenic
944462743 2:199968808-199968830 TAGAGTCATCAAAATAACCTTGG + Intronic
945100783 2:206260616-206260638 TAGGACCCTCAGTAAATCCTTGG + Intergenic
946526441 2:220525572-220525594 TAGTCCCCTGAAAATATCCTTGG - Intergenic
946634917 2:221714049-221714071 TAGGATCTTCAAAATATGCTTGG + Intergenic
948495604 2:238346621-238346643 GTGGACCCTCACAATAACCCAGG + Intronic
1169477519 20:5945906-5945928 TAGAACACTCAATACAACCTAGG + Intronic
1177949320 21:27514219-27514241 TATAACCCACAAAATGACCTAGG + Intergenic
1183073054 22:35409623-35409645 TGGGCCCCTCATAGTAACCTGGG + Intronic
1184125025 22:42480954-42480976 AAGCAAACTCAAAATAACCTGGG + Intergenic
951616990 3:24557967-24557989 TGGGTGCCTCAAAATGACCTAGG + Intergenic
951930802 3:27965005-27965027 TAGGAGCCTCAAAATATGCAAGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955362527 3:58287878-58287900 TTTGAGCCTCAAAATAACCCTGG - Intronic
957758312 3:84521904-84521926 TATTATCCTCACAATAACCTTGG - Intergenic
959272588 3:104232493-104232515 TAGGACACTCAAACTATCTTAGG - Intergenic
961556051 3:127697241-127697263 TAGGGCCCGCAAAAGAGCCTGGG + Intronic
962014915 3:131429842-131429864 TAGGACTCTCAAATTGAACTTGG + Intergenic
963730434 3:148966011-148966033 TAGGTCCCTGAAAATATCATGGG + Intergenic
964302202 3:155301038-155301060 GATGACCCTCAAAATGATCTTGG - Intergenic
966841035 3:184087760-184087782 TAAGGTCCTCAAAATATCCTAGG + Intergenic
967647225 3:191940247-191940269 TAGAACACTAAAAATAACCAGGG + Intergenic
969521641 4:7681302-7681324 TAGGCCCCTCCAGATAACCCAGG - Intronic
969923073 4:10559193-10559215 TAAGACCCTAATATTAACCTAGG - Intronic
969956857 4:10899408-10899430 TGGGACCCTCAAAACTGCCTTGG + Intergenic
974348901 4:60718711-60718733 CAGGAACCTCAAAATAATATGGG - Intergenic
983098871 4:163599787-163599809 TAGTAGCATCAAAATCACCTCGG - Intronic
990962979 5:61414317-61414339 TAGAAACCTCAAAATCACCTTGG - Intronic
991185325 5:63800031-63800053 TAGGACCATCAGAATAACCCAGG + Intergenic
992903615 5:81323421-81323443 TGGGACCATCAGACTAACCTTGG + Intergenic
994156332 5:96507658-96507680 TAGGACTCTGAAAATTACCCAGG + Intergenic
994337237 5:98581705-98581727 TAAGAAACTCAAAATATCCTGGG + Intergenic
994719558 5:103365327-103365349 TAGCACCATCAATATTACCTGGG + Intergenic
997536493 5:134626340-134626362 TAGGAACCTTAAAACAAACTAGG + Intronic
999585845 5:153088721-153088743 TAGGAAGCTAAAAATACCCTGGG - Intergenic
1000492313 5:161929315-161929337 CAGGACCCTCAAACTTCCCTGGG - Intergenic
1000686683 5:164258431-164258453 TAGGATTCTCAAAATTATCTAGG + Intergenic
1000746172 5:165036743-165036765 AAGAACCCACAAAATAACCTAGG - Intergenic
1005097851 6:22137944-22137966 TAAGACACTCAATCTAACCTTGG + Intergenic
1005447430 6:25939113-25939135 AAGGAACCTCAGAATCACCTGGG + Intergenic
1006029206 6:31166834-31166856 TGGGACCCTCAAAGCAAGCTGGG - Intronic
1006412282 6:33881261-33881283 TAAGAGACTCAAAATAACATGGG - Intergenic
1007891690 6:45300393-45300415 AATGACCCTCAAAATAAAATTGG + Intronic
1009240217 6:61176728-61176750 TAGGAACCTCAAAATATTTTGGG + Intergenic
1013321872 6:109000172-109000194 TAGTACCCTAAAAATGCCCTGGG - Intronic
1014433765 6:121399293-121399315 TACAACCCTCAAAGTAAACTAGG + Intergenic
1017742575 6:157420079-157420101 TAGAGACCTTAAAATAACCTGGG - Intronic
1020434769 7:8151023-8151045 TTTAACCCTCAAAATAACCTTGG - Intronic
1028251860 7:88546675-88546697 TAGGTGCCTTAAAATAACATAGG + Intergenic
1029191365 7:98774515-98774537 TAGTACCTTCAAGAGAACCTAGG + Intergenic
1029953482 7:104612302-104612324 TTCAATCCTCAAAATAACCTAGG - Intronic
1030747241 7:113181756-113181778 TTAGATCCTCAAAACAACCTTGG - Intergenic
1031156464 7:118117034-118117056 TAGAACCATCAAAAAGACCTTGG + Intergenic
1031475719 7:122218707-122218729 TGGGACCCACAAAATTATCTGGG - Intergenic
1032666697 7:134043941-134043963 TGGGGCCTTTAAAATAACCTTGG + Intronic
1036034666 8:5005869-5005891 TTGTACTCTCAAAATGACCTGGG - Intergenic
1039993541 8:42511073-42511095 AAGGACCCTCAAAATGACAGTGG + Intronic
1041691233 8:60689570-60689592 TAGTCCCATCAAAATAACCTAGG + Intronic
1042120460 8:65481835-65481857 TATGATCCTAAAAATAGCCTAGG + Intergenic
1042819354 8:72913472-72913494 CAGTACCCTCAAAAGTACCTTGG - Intronic
1045699156 8:104846717-104846739 AAAAACCCTTAAAATAACCTTGG - Intronic
1047477925 8:125252870-125252892 GAGGACACTTTAAATAACCTTGG - Intronic
1048622385 8:136148131-136148153 TTGAACACTCAAAAGAACCTTGG + Intergenic
1050270884 9:3943570-3943592 GAGGACTCTCAAATTAACCAGGG - Intronic
1053077844 9:35150177-35150199 TATGACTGTCAAAATATCCTGGG - Intergenic
1055311385 9:74985395-74985417 GAGGAGCCTCAAGTTAACCTAGG + Intronic
1056825329 9:89872993-89873015 TAGGATCCTAAAAATAGCCTGGG - Intergenic
1058163155 9:101592414-101592436 TTGAATCCTCAAAATAACCCTGG + Exonic
1185665934 X:1765581-1765603 AAGTACCCAGAAAATAACCTTGG - Intergenic
1187267454 X:17747994-17748016 TAGGGCCATCAGAATCACCTGGG + Intronic
1187814648 X:23217849-23217871 CATACCCCTCAAAATAACCTTGG - Intergenic
1189277537 X:39797617-39797639 GAGGACCCTCAAAACTGCCTGGG - Intergenic
1192860529 X:75064538-75064560 TATAAGCCTCAAAATATCCTTGG + Intronic