ID: 1148382480

View in Genome Browser
Species Human (GRCh38)
Location 17:47209905-47209927
Sequence TCCCACTACCTCCTAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148382480_1148382483 6 Left 1148382480 17:47209905-47209927 CCTTTTCCTAGGAGGTAGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1148382483 17:47209934-47209956 TATGGAGAACAGACAGATCATGG 0: 1
1: 0
2: 1
3: 31
4: 235
1148382480_1148382484 26 Left 1148382480 17:47209905-47209927 CCTTTTCCTAGGAGGTAGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1148382484 17:47209954-47209976 TGGCAGCTGCCAGTGTAACTTGG 0: 1
1: 0
2: 2
3: 9
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148382480 Original CRISPR TCCCACTACCTCCTAGGAAA AGG (reversed) Intronic
900935988 1:5766585-5766607 GCCCATTACCCCCTAGGAGAGGG + Intergenic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903403663 1:23078121-23078143 TCTCAGTAACTCCAAGGAAAGGG - Intronic
904415809 1:30360442-30360464 TGCCACCACCTCCAAGGAATGGG - Intergenic
905286509 1:36883870-36883892 TCCCACTGCCTCCTGGAAATGGG + Intronic
906157777 1:43623985-43624007 TCCCACTACCTTGGAGGAGAGGG + Intergenic
906889649 1:49695072-49695094 ACCCACTAACTCCTAAGAAGTGG - Intronic
909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG + Intergenic
911135509 1:94435209-94435231 CCACACTAACTCCTAGGAAGTGG - Intronic
911820589 1:102415028-102415050 TGCCACTTCATCCTAAGAAAGGG + Intergenic
916283956 1:163083686-163083708 ACCCATTGCCTTCTAGGAAAGGG + Intergenic
917199525 1:172500148-172500170 TCTGACTGCCTGCTAGGAAAAGG - Intergenic
917783932 1:178432014-178432036 TCCCACAACCTCCTATAGAAAGG - Intronic
918124540 1:181571328-181571350 TTCTACTTCCTCCTTGGAAAAGG - Intronic
919432292 1:197510838-197510860 TCCCTCCATCTCCTAGGAAGCGG - Intronic
923266079 1:232315528-232315550 TTTCTGTACCTCCTAGGAAATGG + Intergenic
1063696784 10:8343485-8343507 TCTCACTCCTTCCTTGGAAAGGG - Intergenic
1065596293 10:27315257-27315279 TCTAACTAGCTCCAAGGAAATGG + Intergenic
1065597948 10:27335448-27335470 TCTAACTAGCTCCAAGGAAATGG - Intergenic
1067318068 10:45188737-45188759 TCTAACTAGCTCCAAGGAAATGG - Intergenic
1068936443 10:62639803-62639825 TCAGACTCTCTCCTAGGAAAAGG - Intronic
1069079255 10:64070248-64070270 TTCCCCTTCCTCCTTGGAAAAGG + Intergenic
1071950343 10:90696856-90696878 TCCCACTGCCTCTTTGGTAATGG + Intergenic
1072793507 10:98336703-98336725 ATCCACTACTTCCTAGAAAAGGG - Intergenic
1073469794 10:103715503-103715525 TCCATTTGCCTCCTAGGAAAAGG + Intronic
1076223638 10:128756020-128756042 TTCCACTAGCTCCTTGAAAATGG - Intergenic
1076882341 10:133245701-133245723 TCCCCCTGCCCCCTAGGGAACGG - Intergenic
1079019406 11:16896715-16896737 TCCCATTACCTTCTGGAAAAAGG + Intronic
1079041861 11:17066849-17066871 TCCCACGAAGTCCTTGGAAAAGG + Intergenic
1079674482 11:23208501-23208523 TCCCCCTACCGCCTAGTACAAGG - Intergenic
1079778807 11:24571378-24571400 TCCCACAATGTCCTAGGAAAAGG + Intronic
1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG + Intergenic
1084697751 11:70765941-70765963 TCACAGTACCTCCTAGGTAATGG - Intronic
1085201639 11:74705670-74705692 ACGCACTGCCTCCTAGGAAGAGG + Intronic
1088586313 11:111362927-111362949 TCCCAGTCCCTCCCAGGAAGTGG + Intronic
1089369644 11:117946333-117946355 TCCTACTACCTCCTTGCAGATGG + Intergenic
1101932948 12:109029837-109029859 TCACCCTACCTTCTAGGAACCGG - Intronic
1102477413 12:113197482-113197504 TCCCAAGACCTTCTAGGAATGGG - Intronic
1103361826 12:120359098-120359120 ACCCACTACCACCAAGGAACAGG + Intronic
1105224602 13:18418663-18418685 TCTAACTAGCTCCAAGGAAATGG + Intronic
1109378065 13:61523961-61523983 TTCCACTGCCTTCTTGGAAAAGG - Intergenic
1110281048 13:73694948-73694970 TCCCATTACCTGCAAAGAAAGGG - Exonic
1110986841 13:81981946-81981968 TCCCACTACCTCCTTTTAAGAGG - Intergenic
1111287058 13:86108478-86108500 TCTCACTTCCTCATAGGAGAAGG - Intergenic
1114008699 14:18343175-18343197 TCTAACTAGCTCCAAGGAAACGG + Intergenic
1114155112 14:20093647-20093669 TCTCACTGCCTCCTAAGAAGTGG - Intergenic
1114266970 14:21078362-21078384 TCCCACTGCCTCCTGGGGATAGG - Exonic
1117754361 14:58958678-58958700 TCCAACTACCTTGTAGGTAATGG - Intergenic
1119766990 14:77196384-77196406 ACCCACAACCTGCCAGGAAAGGG + Intronic
1121177988 14:91905484-91905506 GCCCAAAACCTCCTAGGACAAGG + Intronic
1122033170 14:98928354-98928376 TGCCCCTAACTCCTAGGGAAGGG - Intergenic
1123391908 15:19883747-19883769 TCTAACTAGCTCCAAGGAAATGG + Intergenic
1124484608 15:30103601-30103623 CCCCGCTACCGCCTGGGAAAGGG - Intergenic
1124497523 15:30195693-30195715 CCCCGCTACCGCCTGGGAAAGGG - Intergenic
1124518973 15:30393637-30393659 CCCCGCTACCGCCTGGGAAAGGG + Intronic
1124539683 15:30572609-30572631 CCCCGCTACCGCCTGGGAAAGGG - Intergenic
1124746065 15:32342998-32343020 CCCCGCTACCGCCTGGGAAAAGG + Intergenic
1124758969 15:32434973-32434995 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1124840800 15:33240522-33240544 ACCCACTGCATCCTGGGAAAGGG + Intergenic
1124973811 15:34515050-34515072 CCCCACTACCGCCTGGGAAAGGG + Intergenic
1125581666 15:40790034-40790056 TGCCACTAACTTCAAGGAAATGG + Intronic
1125899014 15:43328506-43328528 TCCCACCACCTCCAAGGAGCAGG + Exonic
1129483103 15:75843376-75843398 CCCCGCTACCGCCTGGGAAAGGG - Exonic
1130270669 15:82445343-82445365 CCCCGCTACCGCCTGGGAAAGGG - Intergenic
1130489661 15:84422122-84422144 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1130501252 15:84500884-84500906 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1130508774 15:84570985-84571007 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1131999865 15:98167638-98167660 GGCCACTACATTCTAGGAAATGG - Intergenic
1132186450 15:99806001-99806023 CCCCGCTACCGCCTGGGAAAGGG - Intergenic
1132429228 15:101746709-101746731 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1133935634 16:10267078-10267100 TCCAACCCCCTCCTAGCAAACGG - Intergenic
1134340011 16:13336107-13336129 TTCCACTAGCTCCTGGGAGACGG - Intergenic
1134528924 16:14967147-14967169 TCCCACTGCATCCTAGGCACTGG + Intergenic
1135527271 16:23223465-23223487 CACCGCTACCTCCTAGGAAACGG + Intergenic
1135533974 16:23278544-23278566 TCCCACTACCCCCTGGCAATTGG - Intronic
1137774428 16:51043568-51043590 TCCCACAAAGTCCTAGGAAGTGG - Intergenic
1137925068 16:52532745-52532767 TCCCCCTTCTTCCTAGGAATTGG - Intronic
1139055049 16:63173088-63173110 TACCACTAGCATCTAGGAAAAGG + Intergenic
1139241127 16:65393363-65393385 AACCACAACCTCCTAGGAAATGG + Intergenic
1139867442 16:70073831-70073853 TCCCACTGCATCCTAGGCACTGG - Intergenic
1142515005 17:422171-422193 TCCCATCACATCCAAGGAAATGG + Intronic
1143972494 17:10805640-10805662 TCCCACTAGGTCCTCGGAAGGGG + Intergenic
1145255526 17:21320115-21320137 TCCCACAACATCCAAGGAAAAGG + Intergenic
1145321087 17:21767837-21767859 TCCCACAACATCCAAGGAAAAGG - Intergenic
1145992327 17:29086571-29086593 GCCCCCTTCCTCCTAGGAGATGG - Exonic
1146423030 17:32707174-32707196 TCCCACAAATTCATAGGAAAAGG + Intronic
1147799932 17:43077679-43077701 TGCCACTGCCTTCTAGGAAGTGG + Intronic
1148247240 17:46041468-46041490 TCCCAGTTCCTCCTGGGAATCGG + Intronic
1148382480 17:47209905-47209927 TCCCACTACCTCCTAGGAAAAGG - Intronic
1149838642 17:59937920-59937942 TCCAACTACATCCTAAGGAATGG - Intronic
1153918830 18:9770542-9770564 TCCATCTACTTCCTGGGAAATGG - Intronic
1154528752 18:15320787-15320809 TCTAACTAGCTCCAAGGAAATGG - Intergenic
1156308969 18:35905278-35905300 TAACAATACTTCCTAGGAAATGG + Intergenic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1161417198 19:4153962-4153984 TCCCCCTGCCTCCTAGGAGCGGG + Intronic
1162426244 19:10598100-10598122 TCTCACTACCTCCCTGGAGATGG - Intergenic
1164446928 19:28325705-28325727 GCGCACTGCCTCCTGGGAAAAGG - Intergenic
1166358533 19:42242031-42242053 GCCCTCTTCCTCCCAGGAAAAGG - Intronic
1166528510 19:43527931-43527953 TCCTACCACCTGCTAGAAAACGG - Intronic
1167869499 19:52355968-52355990 ACCCACTAGCTTCTAGGAGAGGG - Intronic
1167914912 19:52733032-52733054 TCCTACCCCATCCTAGGAAAAGG + Intronic
926610351 2:14940673-14940695 TCCCACTACCTCCCAGAAATGGG + Intergenic
933638997 2:84739904-84739926 TCCCACTAGCTCCCAAGCAATGG - Intronic
935682933 2:105653359-105653381 TGCCACAGCCTCCTGGGAAATGG + Intergenic
936119156 2:109726542-109726564 TCACACAGCCTCCTTGGAAACGG - Intergenic
938527863 2:132152190-132152212 TCTAACTAGCTCCAAGGAAATGG - Intronic
938675968 2:133634284-133634306 TCCCACTCCCTCGTAACAAAGGG + Intergenic
940967891 2:159860514-159860536 TCCCACCTCTTCCTGGGAAATGG + Intronic
948196881 2:236103213-236103235 GCCCACTGCCTCCCAGAAAAAGG + Intronic
948368651 2:237474276-237474298 TCCCACTGTTTCCTTGGAAACGG + Intergenic
1170040677 20:12036271-12036293 TCCTAGAACCCCCTAGGAAAAGG - Intergenic
1171326720 20:24300833-24300855 TCCCACTAGCTCCCAGGCTAGGG - Intergenic
1172603999 20:36202437-36202459 TCCCACTTTCTCCCAGGAAATGG + Intronic
1173698269 20:45042367-45042389 TCCCACTCCATCCAAAGAAAGGG + Intronic
1174288206 20:49487051-49487073 TCCCACTAGCCCATAGGAAATGG + Intergenic
1174382377 20:50164359-50164381 TCCCACCTGCTCCCAGGAAAAGG - Intergenic
1175808946 20:61847179-61847201 TCCCACCAACTCCCCGGAAAAGG + Intronic
1176385586 21:6137372-6137394 CCCCGCTACGTCCTGGGAAATGG + Intergenic
1176768647 21:13047720-13047742 TCTAACTAGCTCCAAGGAAATGG + Intergenic
1177097911 21:16861131-16861153 TACCCCTACCTCCTAGAATAGGG + Intergenic
1177807716 21:25890383-25890405 TTCCACTATCCCCAAGGAAATGG - Intronic
1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG + Intergenic
1179199599 21:39204181-39204203 TACCACCACCACCTAGGAAGGGG + Intronic
1179737887 21:43400880-43400902 CCCCGCTACGTCCTGGGAAATGG - Intergenic
1180020501 21:45122444-45122466 CCCCACTATCTCCTAACAAAGGG - Intronic
1180433204 22:15273992-15274014 TCTAACTAGCTCCAAGGAAATGG + Intergenic
1180515778 22:16141903-16141925 TCTAACTAGCTCCAAGGAAATGG + Intergenic
1181085005 22:20435910-20435932 TCCTCCTGCCTCCCAGGAAAGGG + Intronic
1182120256 22:27781813-27781835 TCCCACTATCTCCTGGGGCAGGG + Intronic
949929661 3:9068839-9068861 TCACACTACCTCCCAGGATTAGG - Intronic
951955548 3:28249448-28249470 TCCCTCTAACTCCTAGCATATGG - Intronic
952085159 3:29811892-29811914 TTCCACAACTTCCTAAGAAACGG - Intronic
954779938 3:53051480-53051502 TCCCACTGCCTCTTGGGGAAAGG - Intronic
955957919 3:64309545-64309567 ACCAACTACTTACTAGGAAATGG + Intronic
960909462 3:122634411-122634433 TTCTCCTTCCTCCTAGGAAATGG - Intronic
962978044 3:140463413-140463435 TCCCCCTGCCTGCTAGGAAAGGG + Intronic
964870550 3:161309701-161309723 GCTTACTACCTCCCAGGAAATGG - Intergenic
968221960 3:196946308-196946330 TCCCACCACCTCTCAGGAACAGG + Intergenic
973995317 4:56452735-56452757 TCTGACTGCCTCCCAGGAAAGGG - Intronic
975608432 4:76179767-76179789 TCCTACTACCCCATAGCAAAGGG + Intronic
977568301 4:98604561-98604583 TCCCACTACTGCCTAGATAATGG - Intronic
977573710 4:98656287-98656309 TACCACCCCCTGCTAGGAAACGG + Intronic
977855550 4:101886291-101886313 TCCCACTGCCTCCTCAAAAAGGG - Intronic
980088271 4:128415225-128415247 TCCCACTAGCTCCCAAGCAATGG - Intergenic
981516088 4:145611645-145611667 TTCCACAAAGTCCTAGGAAATGG - Intergenic
985510094 5:308554-308576 TCCCACGTCTTCCTTGGAAAGGG + Intronic
989504849 5:42215616-42215638 ACCCACTATCTTCAAGGAAAAGG - Intergenic
991284837 5:64961110-64961132 TCTGACTAGCTCCTAGGGAAAGG + Intronic
993270252 5:85787348-85787370 TCACACTTCCTCGTAGGAAGTGG - Intergenic
995550239 5:113274276-113274298 ACCAACTTCCCCCTAGGAAAGGG + Intronic
1002173917 5:177390890-177390912 TCCAACTAGCCCCTGGGAAAAGG + Intronic
1004182920 6:13396455-13396477 TGGCACCAACTCCTAGGAAAAGG - Intronic
1005173453 6:23015052-23015074 TTCCACTTCCTCCTATGACATGG - Intergenic
1005432525 6:25773264-25773286 AGCCAATTCCTCCTAGGAAAAGG - Exonic
1007473638 6:42105715-42105737 TTCCACTCCCTCCCAGGCAAGGG - Exonic
1007711343 6:43826194-43826216 TACCACCACCTCCCAGGGAAGGG + Intergenic
1009355526 6:62739982-62740004 GCCCAGTGGCTCCTAGGAAAGGG + Intergenic
1011184039 6:84654506-84654528 TCTCACTGCCTTCTAGAAAATGG - Intergenic
1011351958 6:86433370-86433392 TCCTACTGCCTCCCAGAAAAGGG + Intergenic
1011531079 6:88321633-88321655 TCCCTGTACCTCCTATGAGATGG + Intergenic
1013735258 6:113219663-113219685 ACCCACTCCCCCCTAGAAAATGG + Intergenic
1014248768 6:119094995-119095017 TCCCACTGCTTCCTTGGTAAAGG + Intronic
1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG + Intronic
1016570604 6:145507943-145507965 CCCCACTAGCTCCAAGGAACAGG + Intronic
1018735720 6:166685935-166685957 TCCCCCTCCCTCCTAGGGCATGG - Intronic
1019042785 6:169120356-169120378 TCCCACTACCTTCCTGGGAAAGG + Intergenic
1021236736 7:18151707-18151729 TTCCACTATCTCCTTGGGAATGG + Intronic
1021626949 7:22602934-22602956 TCCCAATAACTACCAGGAAAGGG + Intronic
1023760019 7:43456579-43456601 TCCAAATACCTACTAGGAACAGG - Intronic
1029008466 7:97233736-97233758 TGCCTCTACCTCCTAAGAACTGG + Intergenic
1031502101 7:122531469-122531491 TCCCACTAACTCTTAAGAATGGG + Intronic
1031547595 7:123068910-123068932 TCCCAGTGACTCCTGGGAAAGGG - Intergenic
1033981342 7:147169972-147169994 GCCCACTACCTCCTCAGCAATGG - Intronic
1038914368 8:32004152-32004174 CCCCACGACCTTCTGGGAAAGGG + Intronic
1040082619 8:43303513-43303535 TCTGACTAGCTCCAAGGAAATGG + Intergenic
1040610421 8:48977464-48977486 TCCCAGTTCCTCCTGGGACAGGG + Intergenic
1040846386 8:51846356-51846378 ACGGACTACCTCCCAGGAAAAGG + Intronic
1041012469 8:53558569-53558591 TCACACTCCCACCCAGGAAAGGG + Intergenic
1041055260 8:53979165-53979187 GCCCCCTACCTCATAGGAAATGG - Exonic
1041384825 8:57289680-57289702 TCTTACTAGCTCCAAGGAAATGG + Intergenic
1041446211 8:57953667-57953689 CCCCATTACCTCCTTGGTAAGGG + Intergenic
1042376240 8:68056102-68056124 TCCTGCTACCGCCCAGGAAATGG - Intronic
1042857785 8:73285478-73285500 TCCCACTCCCTCCCACGAAGGGG - Intergenic
1043106303 8:76116021-76116043 TCAGAATGCCTCCTAGGAAAGGG - Intergenic
1047313542 8:123711970-123711992 CCCCACCATCTCCTAGGGAAGGG + Intronic
1049078533 8:140421088-140421110 TTCCACTGTCTCCTAGGGAAAGG - Intronic
1049146761 8:141006269-141006291 TCCCACTTCCTCACAGGAGATGG - Intergenic
1049414200 8:142487960-142487982 CCCCACTCCCTCCTGGGACAGGG - Intronic
1050155143 9:2659002-2659024 TTTGACTACCTCCTAGGACATGG + Exonic
1052049595 9:23830232-23830254 TCCCTCCACCCCCTAGCAAAGGG + Intergenic
1053706540 9:40759547-40759569 TCTAACTAGCTCCAAGGAAATGG - Intergenic
1054416454 9:64880316-64880338 TCTAACTAGCTCCAAGGAAATGG - Intergenic
1057480579 9:95442109-95442131 TCCCCCTCCCCTCTAGGAAAGGG + Intergenic
1185620681 X:1451132-1451154 TCCCAGGACCCCCTAGGAATGGG - Intronic
1186121774 X:6371326-6371348 TCCCTTTACCTCTTAGGGAAGGG - Intergenic
1187856242 X:23638189-23638211 TCCCCCTACCTTCAAGCAAATGG + Intergenic
1189172961 X:38926774-38926796 TCTCACTGCCTCATAGGACAAGG - Intergenic
1189725713 X:43966448-43966470 ACCCACTCCCTCCCAGGAAGGGG + Intronic
1189899031 X:45686880-45686902 CCCATCTACCTCATAGGAAAAGG + Intergenic
1198274864 X:135090706-135090728 TCCCAGTTCCTCCCAGGAAGAGG - Intergenic
1201708139 Y:16959372-16959394 TCCAAATTCCTCCTGGGAAAGGG - Intergenic
1202080446 Y:21078698-21078720 TCACAATACCTCCTAAGAAAAGG - Intergenic
1202372177 Y:24205945-24205967 CCCCGCTACCGCCTGGGAAAGGG + Intergenic
1202498608 Y:25464171-25464193 CCCCGCTACCGCCTGGGAAAGGG - Intergenic